Rmu_sc0001551.1_g000014

LRR-repeat protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001551.1
OG0003953
Physical Location & Seq
Forward (+)
85803 .. 86183
381 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001551.1_g000014.1.cds

Sequence Viewer

Length: 381 bp
atggaccgactcaatgatcttccgcacgaagtcactcatcatattctctccttcctccccatagccgactcaactcgagtcgacatcttatccaaaagatgcagaggaatttacttgtcaaatcctactttgaatttcaccgagtttcctttcgagctcaccctcatctccaatgggcgctctcaaattttgaattccttagatggcttcttcaacattcatcgtgccttcaacaaaatacagagcttctgtgtcaattgggtttctcgattcgatccaaggaaaattgaactaagcggaatccagagtctttctagtgaggagatttctcaaatcctcgtttgggttcaaactgcagtcttgaggtgcaacgtggaatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
F-box F-box-like FBD

Protein Analysis

126

Amino Acids

14.52

Weight (kDa)

6.41

Isoelectric Point (pI)

53.35

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 81
AciI CCGC 2 cut(s) 23, 297
AclWI GGATC 1 cut(s) 269
AcsI RAATTY 4 cut(s) 108, 133, 186, 193
AfiI CCNNNNNNNGG 1 cut(s) 343
AgsI TTSAA 6 cut(s) 133, 193, 214, 232, 290, 350
AluBI AGCT 2 cut(s) 157, 246
AluI AGCT 2 cut(s) 157, 246
Alw21I GWGCWC 1 cut(s) 159
AlwI GGATC 1 cut(s) 269
Ama87I CYCGRG 1 cut(s) 75
ApoI RAATTY 4 cut(s) 108, 133, 186, 193
AspLEI GCGC 1 cut(s) 180
AspS9I GGNCC 1 cut(s) 4
AsuHPI GGTGA 2 cut(s) 130, 151
AvaI CYCGRG 1 cut(s) 75
AvaII GGWCC 1 cut(s) 4
BanII GRGCYC 1 cut(s) 159
Bbv12I GWGCWC 1 cut(s) 159
BccI CCATC 1 cut(s) 197
BfaI CTAG 1 cut(s) 315
BfmI CTRYAG 1 cut(s) 354
BfoI RGCGCY 1 cut(s) 181
Bme18I GGWCC 1 cut(s) 4
BmeT110I CYCGRG 1 cut(s) 75
BmgT120I GGNCC 1 cut(s) 4
BmsI GCATC 1 cut(s) 89
BsaJI CCNNGG 1 cut(s) 278
Bsc4I CCNNNNNNNGG 1 cut(s) 343
BseDI CCNNGG 1 cut(s) 278
BseLI CCNNNNNNNGG 1 cut(s) 343
BseRI GAGGAG 1 cut(s) 335
BsiHKAI GWGCWC 1 cut(s) 159
BsiHKCI CYCGRG 1 cut(s) 75
BslI CCNNNNNNNGG 1 cut(s) 343
BsoBI CYCGRG 1 cut(s) 75
Bsp1286I GDGCHC 1 cut(s) 159
Bsp143I GATC 2 cut(s) 16, 274
BspACI CCGC 2 cut(s) 23, 297
BspMAI CTGCAG 1 cut(s) 358
BspPI GGATC 1 cut(s) 269
BssECI CCNNGG 1 cut(s) 278
BssMI GATC 2 cut(s) 16, 274
BssT1I CCWWGG 1 cut(s) 278
BstDEI CTNAG 2 cut(s) 199, 293
BstH2I RGCGCY 1 cut(s) 181
BstHHI GCGC 1 cut(s) 180
BstKTI GATC 2 cut(s) 19, 277
BstMBI GATC 2 cut(s) 16, 274
BstSFI CTRYAG 1 cut(s) 354
CfoI GCGC 1 cut(s) 180
Cfr13I GGNCC 1 cut(s) 4
CviJI RGCY 4 cut(s) 65, 157, 207, 246
CviKI_1 RGCY 4 cut(s) 65, 157, 207, 246
DdeI CTNAG 2 cut(s) 199, 293
DpnI GATC 2 cut(s) 18, 276
DpnII GATC 2 cut(s) 16, 274
Ecl136II GAGCTC 1 cut(s) 157
Eco130I CCWWGG 1 cut(s) 278
Eco24I GRGCYC 1 cut(s) 159
Eco47I GGWCC 1 cut(s) 4
Eco53kI GAGCTC 1 cut(s) 157
Eco88I CYCGRG 1 cut(s) 75
EcoICRI GAGCTC 1 cut(s) 157
EcoRI GAATTC 1 cut(s) 193
EcoT14I CCWWGG 1 cut(s) 278
EcoT38I GRGCYC 1 cut(s) 159
ErhI CCWWGG 1 cut(s) 278
FaiI YATR 2 cut(s) 42, 62
FblI GTMKAC 1 cut(s) 81
FriOI GRGCYC 1 cut(s) 159
FspBI CTAG 1 cut(s) 315
GlaI GCGC 1 cut(s) 179
HaeII RGCGCY 1 cut(s) 181
HhaI GCGC 1 cut(s) 180
Hin6I GCGC 1 cut(s) 178
HinP1I GCGC 1 cut(s) 178
HincII GTYRAC 1 cut(s) 82
HindII GTYRAC 1 cut(s) 82
HinfI GANTC 6 cut(s) 9, 68, 78, 270, 300, 307
HphI GGTGA 2 cut(s) 130, 151
Hpy166II GTNNAC 1 cut(s) 82
Hpy188III TCNNGA 3 cut(s) 267, 304, 361
Hpy8I GTNNAC 1 cut(s) 82
HpyAV CCTTC 2 cut(s) 61, 238
HpyCH4IV ACGT 1 cut(s) 372
HpyCH4V TGCA 3 cut(s) 102, 356, 369
HpyF3I CTNAG 2 cut(s) 199, 293
HpySE526I ACGT 1 cut(s) 372
HspAI GCGC 1 cut(s) 178
Kzo9I GATC 2 cut(s) 16, 274
LpnPI CCDG 1 cut(s) 317
LweI GCATC 1 cut(s) 89
MaeI CTAG 1 cut(s) 315
MaeII ACGT 1 cut(s) 372
MaeIII GTNAC 1 cut(s) 31
MalI GATC 2 cut(s) 18, 276
MboI GATC 2 cut(s) 16, 274
MboII GAAGA 2 cut(s) 11, 202
MfeI CAATTG 1 cut(s) 256
MhlI GDGCHC 1 cut(s) 159
MluCI AATT 6 cut(s) 108, 133, 186, 193, 256, 285
MlyI GAGTC 4 cut(s) 3, 62, 87, 316
MnlI CCTC 6 cut(s) 65, 98, 173, 313, 347, 357
MunI CAATTG 1 cut(s) 256
NdeII GATC 2 cut(s) 16, 274
NmuCI GTSAC 1 cut(s) 31
PaeR7I CTCGAG 1 cut(s) 75
PfeI GAWTC 2 cut(s) 270, 300
PleI GAGTC 4 cut(s) 3, 62, 86, 315
PpsI GAGTC 4 cut(s) 3, 62, 86, 315
Psp124BI GAGCTC 1 cut(s) 159
PspPI GGNCC 1 cut(s) 4
PspXI VCTCGAGB 1 cut(s) 75
PstI CTGCAG 1 cut(s) 358
SacI GAGCTC 1 cut(s) 159
SalI GTCGAC 1 cut(s) 80
Sau3AI GATC 2 cut(s) 16, 274
Sau96I GGNCC 1 cut(s) 4
SchI GAGTC 4 cut(s) 3, 62, 87, 316
SduI GDGCHC 1 cut(s) 159
SetI ASST 4 cut(s) 159, 248, 368, 375
SfaNI GCATC 1 cut(s) 89
SfcI CTRYAG 1 cut(s) 354
Sfr274I CTCGAG 1 cut(s) 75
SinI GGWCC 1 cut(s) 4
SlaI CTCGAG 1 cut(s) 75
SmlI CTYRAG 2 cut(s) 75, 361
SmoI CTYRAG 2 cut(s) 75, 361
Sse9I AATT 6 cut(s) 108, 133, 186, 193, 256, 285
SsiI CCGC 2 cut(s) 23, 297
SspMI CTAG 1 cut(s) 315
SstI GAGCTC 1 cut(s) 159
StyI CCWWGG 1 cut(s) 278
TaiI ACGT 1 cut(s) 375
TaqI TCGA 5 cut(s) 76, 81, 153, 268, 273
TaqII GACCGA 1 cut(s) 21
TasI AATT 6 cut(s) 108, 133, 186, 193, 256, 285
TfiI GAWTC 2 cut(s) 270, 300
TseFI GTSAC 1 cut(s) 31
Tsp45I GTSAC 1 cut(s) 31
TspDTI ATGAA 1 cut(s) 209
VpaK11BI GGWCC 1 cut(s) 4
XapI RAATTY 4 cut(s) 108, 133, 186, 193
XhoI CTCGAG 1 cut(s) 75
XmiI GTMKAC 1 cut(s) 81
XspI CTAG 1 cut(s) 315
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.