Rh7DG163400

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7D
Physical Location & Seq
Forward (+)
14566093 .. 14566393
301 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7DG163400.1

Sequence Viewer

Length: 204 bp
ATGTTCCTCAATGTGGCTCCTCTGATGTCCTCATCATCATCTCCGCTGAGAGCAGACAACAAGGCATTAATGCCGCTAAGTGATTCTATGGGAATGGCAAGCCAGAGTGCAACAACTCTTTACGGGATAAAACCTACAAATCAATGCAGTGGTATCATGGAGGCATTCGATCTGAGTGCTGCTGAATTCCGCAATCAATCCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

67

Amino Acids

7.12

Weight (kDa)

4.86

Isoelectric Point (pI)

61.62

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 3 cut(s) 44, 74, 190
AcsI RAATTY 1 cut(s) 185
AfiI CCNNNNNNNGG 1 cut(s) 13
ApeKI GCWGC 1 cut(s) 179
ApoI RAATTY 1 cut(s) 185
AseI ATTAAT 1 cut(s) 68
BbvI GCAGC 1 cut(s) 166
BcgI CGANNNNNNTGC 2 cut(s) 158, 192
BisI GCNGC 2 cut(s) 74, 180
BlsI GCNGC 2 cut(s) 75, 181
BmiI GGNNCC 1 cut(s) 18
Bsc4I CCNNNNNNNGG 1 cut(s) 13
BseLI CCNNNNNNNGG 1 cut(s) 13
BseMII CTCAG 2 cut(s) 38, 164
BseRI GAGGAG 1 cut(s) 9
BseXI GCAGC 1 cut(s) 166
BslI CCNNNNNNNGG 1 cut(s) 13
BsmI GAATGC 1 cut(s) 164
Bsp143I GATC 1 cut(s) 169
BspACI CCGC 3 cut(s) 44, 74, 190
BspCNI CTCAG 2 cut(s) 39, 165
BspLI GGNNCC 1 cut(s) 18
BssMI GATC 1 cut(s) 169
BstC8I GCNNGC 1 cut(s) 100
BstDEI CTNAG 3 cut(s) 47, 77, 173
BstKTI GATC 1 cut(s) 172
BstMBI GATC 1 cut(s) 169
BstV1I GCAGC 1 cut(s) 166
BtsI GCAGTG 1 cut(s) 154
BtsIMutI CAGTG 1 cut(s) 154
Cac8I GCNNGC 1 cut(s) 100
CviAII CATG 1 cut(s) 157
CviJI RGCY 2 cut(s) 17, 102
CviKI_1 RGCY 2 cut(s) 17, 102
DdeI CTNAG 3 cut(s) 47, 77, 173
DpnI GATC 1 cut(s) 171
DpnII GATC 1 cut(s) 169
EcoRI GAATTC 1 cut(s) 185
FaeI CATG 1 cut(s) 160
FaiI YATR 2 cut(s) 89, 158
FatI CATG 1 cut(s) 156
Fnu4HI GCNGC 2 cut(s) 74, 180
Fsp4HI GCNGC 2 cut(s) 74, 180
GluI GCNGC 2 cut(s) 74, 180
Hin1II CATG 1 cut(s) 160
HinfI GANTC 1 cut(s) 83
Hpy188I TCNGA 2 cut(s) 24, 174
HpyCH4V TGCA 2 cut(s) 110, 147
HpyF3I CTNAG 3 cut(s) 47, 77, 173
Hsp92II CATG 1 cut(s) 160
Kzo9I GATC 1 cut(s) 169
LmnI GCTCC 1 cut(s) 22
LpnPI CCDG 1 cut(s) 116
Lsp1109I GCAGC 1 cut(s) 166
MalI GATC 1 cut(s) 171
MboI GATC 1 cut(s) 169
MluCI AATT 1 cut(s) 185
MnlI CCTC 4 cut(s) 17, 30, 40, 154
MseI TTAA 1 cut(s) 68
MspA1I CMGCKG 1 cut(s) 46
Mva1269I GAATGC 1 cut(s) 164
NdeII GATC 1 cut(s) 169
NlaIII CATG 1 cut(s) 160
NlaIV GGNNCC 1 cut(s) 18
PctI GAATGC 1 cut(s) 164
PfeI GAWTC 1 cut(s) 83
PkrI GCNGC 2 cut(s) 75, 181
PshBI ATTAAT 1 cut(s) 68
PspN4I GGNNCC 1 cut(s) 18
SaqAI TTAA 1 cut(s) 68
SatI GCNGC 2 cut(s) 74, 180
Sau3AI GATC 1 cut(s) 169
SetI ASST 1 cut(s) 136
SgeI CNNG 5 cut(s) 73, 111, 115, 136, 169
Sse9I AATT 1 cut(s) 185
SsiI CCGC 3 cut(s) 44, 74, 190
TaqI TCGA 1 cut(s) 168
TasI AATT 1 cut(s) 185
TauI GCSGC 1 cut(s) 76
TfiI GAWTC 1 cut(s) 83
Tru1I TTAA 1 cut(s) 68
Tru9I TTAA 1 cut(s) 68
TscAI CASTG 1 cut(s) 154
TseI GCWGC 1 cut(s) 179
TspRI CASTG 1 cut(s) 154
VspI ATTAAT 1 cut(s) 68
XapI RAATTY 1 cut(s) 185
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.