Rh3BG217200

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3B
Physical Location & Seq
Forward (+)
19599595 .. 19599842
248 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3BG217200.1

Sequence Viewer

Length: 186 bp
ATGTTCCTCAATGTGGCTCCTCTGATGTCCTCATCATCATCTCCGCTGAGAGCAGACAACAAGGCATTAATGCCACTAAGTGATTCTATAAGACCAGAACAATTGATAATCAAGATCAGGGAATGGGAATGGCAAGCCAGAGTGCAACAACTCGATGTTACACACAAGCTGACGACTAAAGTCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

61

Amino Acids

7.02

Weight (kDa)

9.52

Isoelectric Point (pI)

60.35

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 44
AdeI CACNNNGTG 1 cut(s) 80
AfiI CCNNNNNNNGG 1 cut(s) 13
AluBI AGCT 1 cut(s) 169
AluI AGCT 1 cut(s) 169
AseI ATTAAT 1 cut(s) 68
BmiI GGNNCC 1 cut(s) 18
BoxI GACNNNNGTC 1 cut(s) 179
Bsc4I CCNNNNNNNGG 1 cut(s) 13
BseLI CCNNNNNNNGG 1 cut(s) 13
BseMII CTCAG 1 cut(s) 38
BseRI GAGGAG 1 cut(s) 9
BslI CCNNNNNNNGG 1 cut(s) 13
Bsp143I GATC 1 cut(s) 114
BspACI CCGC 1 cut(s) 44
BspCNI CTCAG 1 cut(s) 39
BspLI GGNNCC 1 cut(s) 18
BssMI GATC 1 cut(s) 114
BstC8I GCNNGC 1 cut(s) 135
BstDEI CTNAG 2 cut(s) 47, 77
BstKTI GATC 1 cut(s) 117
BstMBI GATC 1 cut(s) 114
BstPAI GACNNNNGTC 1 cut(s) 179
Cac8I GCNNGC 1 cut(s) 135
CviJI RGCY 3 cut(s) 17, 137, 169
CviKI_1 RGCY 3 cut(s) 17, 137, 169
DdeI CTNAG 2 cut(s) 47, 77
DpnI GATC 1 cut(s) 116
DpnII GATC 1 cut(s) 114
DraIII CACNNNGTG 1 cut(s) 80
FaiI YATR 1 cut(s) 89
HinfI GANTC 1 cut(s) 83
Hpy188I TCNGA 1 cut(s) 24
Hpy188III TCNNGA 1 cut(s) 112
HpyCH4V TGCA 1 cut(s) 145
HpyF3I CTNAG 2 cut(s) 47, 77
Kzo9I GATC 1 cut(s) 114
LmnI GCTCC 1 cut(s) 22
LpnPI CCDG 3 cut(s) 103, 108, 151
MaeIII GTNAC 1 cut(s) 157
MalI GATC 1 cut(s) 116
MboI GATC 1 cut(s) 114
MfeI CAATTG 1 cut(s) 101
MluCI AATT 1 cut(s) 101
MnlI CCTC 3 cut(s) 17, 30, 40
MseI TTAA 1 cut(s) 68
MspA1I CMGCKG 1 cut(s) 46
MunI CAATTG 1 cut(s) 101
NdeII GATC 1 cut(s) 114
NlaIV GGNNCC 1 cut(s) 18
PfeI GAWTC 1 cut(s) 83
PshAI GACNNNNGTC 1 cut(s) 179
PshBI ATTAAT 1 cut(s) 68
PspN4I GGNNCC 1 cut(s) 18
SaqAI TTAA 1 cut(s) 68
Sau3AI GATC 1 cut(s) 114
SetI ASST 1 cut(s) 171
SgeI CNNG 8 cut(s) 73, 107, 124, 130, 146, 150, 164, 178
Sse9I AATT 1 cut(s) 101
SsiI CCGC 1 cut(s) 44
TaqI TCGA 1 cut(s) 153
TasI AATT 1 cut(s) 101
TfiI GAWTC 1 cut(s) 83
Tru1I TTAA 1 cut(s) 68
Tru9I TTAA 1 cut(s) 68
VspI ATTAAT 1 cut(s) 68
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.