Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001896.1

Orthogroup ID

OG0006957

Physical Location & Seq

Genomic Coordinates Forward (+)

101098 .. 101418

Gene Structure 321 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001896.1_g000036.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 321 bp

atgattacgtggccgttgatcagcgatgagcagttttacaatgagaagttggtgactgagatacttgggattggtgttcccgttggttctgaacaatgggtttcatttgtggatctacctgcgaagactgaagcgagtgtgaggaggggggccatagagaaagctgtgactagaatcatggtaggtgatgaagcagtagaaatgagaagcagggttaaagagcttggagagaaagcaaggagggccgtggaagaaggtggctcatctttcttgaatttaatttctctagttgaagagttgaaccgccttctggaggcttag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko00906 ko01100 ko01110 map00906 map01100 map01110

Pfam Domains

Protein Families

UDPGT

Protein Analysis

106

Amino Acids

11.8

Weight (kDa)

4.82

Isoelectric Point (pI)

50.57

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0006957)

Species	Orthologous Gene IDs
malus_domestica	MD05G1091600.v1.1
rosa_chinensis	RchiOBHm_Chr6g0256091 RchiOBHm_Chr6g0256181 RchiOBHm_Chr6g0256281 RchiOBHm_Chr6g0256491 RchiOBHm_Chr6g0257741
rosa_laevigata	RLG00000013347 RLG00000013350 RLG00000013353 RLG00000014801 RLG00000015131
rosa_multiflora	Rmu_sc0001425.1_g000009 Rmu_sc0001425.1_g000017 Rmu_sc0001896.1_g000016 Rmu_sc0001896.1_g000036 Rmu_sc0001896.1_g000038 Rmu_sc0003882.1_g000011 Rmu_sc0004961.1_g000013 Rmu_sc0011315.1_g000008
rosa_roxburghii	Rroxscaffold_2G00108560
rosa_rugosa	Rorug04G0081600 Rorug05G0562700 Rorug05G0562900 Rorug05G0563200 Rorug05G0563900 Rorug06G0169300

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	127
AciI	CCGC	1 cut(s)	304
AclWI	GGATC	1 cut(s)	120
AcoI	YGGCCR	1 cut(s)	11
AcsI	RAATTY	1 cut(s)	274
AcuI	CTGAAG	1 cut(s)	150
AfiI	CCNNNNNNNGG	2 cut(s)	310, 313
AgsI	TTSAA	3 cut(s)	274, 293, 301
AluBI	AGCT	2 cut(s)	164, 223
AluI	AGCT	2 cut(s)	164, 223
AlwI	GGATC	1 cut(s)	120
AoxI	GGCC	3 cut(s)	11, 150, 243
ApoI	RAATTY	1 cut(s)	274
AspS9I	GGNCC	2 cut(s)	150, 243
AsuHPI	GGTGA	2 cut(s)	64, 197
BbsI	GAAGAC	1 cut(s)	131
BceAI	ACGGC	1 cut(s)	230
BclI	TGATCA	1 cut(s)	18
BfaI	CTAG	2 cut(s)	171, 287
BfuAI	ACCTGC	1 cut(s)	127
BmgT120I	GGNCC	2 cut(s)	150, 243
BmiI	GGNNCC	1 cut(s)	151
BpiI	GAAGAC	1 cut(s)	131
BsaAI	YACGTR	1 cut(s)	9
BsaJI	CCNNGG	1 cut(s)	246
Bsc4I	CCNNNNNNNGG	2 cut(s)	310, 313
BseDI	CCNNGG	1 cut(s)	246
BseLI	CCNNNNNNNGG	2 cut(s)	310, 313
BseMII	CTCAG	1 cut(s)	48
BseRI	GAGGAG	1 cut(s)	157
BshFI	GGCC	3 cut(s)	13, 152, 245
BslI	CCNNNNNNNGG	2 cut(s)	310, 313
BsnI	GGCC	3 cut(s)	13, 152, 245
Bsp143I	GATC	2 cut(s)	18, 112
BspACI	CCGC	1 cut(s)	304
BspANI	GGCC	3 cut(s)	13, 152, 245
BspCNI	CTCAG	1 cut(s)	49
BspLI	GGNNCC	1 cut(s)	151
BspMI	ACCTGC	1 cut(s)	127
BspPI	GGATC	1 cut(s)	120
BssECI	CCNNGG	1 cut(s)	246
BssMI	GATC	2 cut(s)	18, 112
Bst6I	CTCTTC	1 cut(s)	288
BstBAI	YACGTR	1 cut(s)	9
BstDEI	CTNAG	2 cut(s)	57, 318
BstDSI	CCRYGG	1 cut(s)	246
BstENI	CCTNNNNNAGG	1 cut(s)	311
BstKTI	GATC	2 cut(s)	21, 115
BstMBI	GATC	2 cut(s)	18, 112
BstMWI	GCNNNNNNNGC	1 cut(s)	242
BstV2I	GAAGAC	1 cut(s)	131
BstX2I	RGATCY	1 cut(s)	112
BstYI	RGATCY	1 cut(s)	112
BsuRI	GGCC	3 cut(s)	13, 152, 245
BtgI	CCRYGG	1 cut(s)	246
BtgZI	GCGATG	1 cut(s)	39
BveI	ACCTGC	1 cut(s)	127
Cfr13I	GGNCC	2 cut(s)	150, 243
CviAII	CATG	1 cut(s)	178
CviJI	RGCY	7 cut(s)	13, 152, 164, 223, 245, 261, 317
CviKI_1	RGCY	7 cut(s)	13, 152, 164, 223, 245, 261, 317
DdeI	CTNAG	2 cut(s)	57, 318
DpnI	GATC	2 cut(s)	20, 114
DpnII	GATC	2 cut(s)	18, 112
EaeI	YGGCCR	1 cut(s)	11
Eam1104I	CTCTTC	1 cut(s)	288
EarI	CTCTTC	1 cut(s)	288
Eco57I	CTGAAG	1 cut(s)	150
EcoNI	CCTNNNNNAGG	1 cut(s)	311
FaeI	CATG	1 cut(s)	181
FaiI	YATR	2 cut(s)	155, 179
FatI	CATG	1 cut(s)	177
FbaI	TGATCA	1 cut(s)	18
FspBI	CTAG	2 cut(s)	171, 287
HaeIII	GGCC	3 cut(s)	13, 152, 245
Hin1II	CATG	1 cut(s)	181
HinfI	GANTC	1 cut(s)	174
HphI	GGTGA	2 cut(s)	64, 197
Hpy188I	TCNGA	1 cut(s)	91
Hpy188III	TCNNGA	2 cut(s)	271, 311
HpyAV	CCTTC	2 cut(s)	248, 317
HpyCH4IV	ACGT	1 cut(s)	8
HpyF10VI	GCNNNNNNNGC	1 cut(s)	242
HpyF3I	CTNAG	2 cut(s)	57, 318
HpySE526I	ACGT	1 cut(s)	8
Hsp92II	CATG	1 cut(s)	181
Ksp22I	TGATCA	1 cut(s)	18
Kzo9I	GATC	2 cut(s)	18, 112
LpnPI	CCDG	3 cut(s)	132, 196, 296
MaeI	CTAG	2 cut(s)	171, 287
MaeII	ACGT	1 cut(s)	8
MaeIII	GTNAC	2 cut(s)	52, 166
MalI	GATC	2 cut(s)	20, 114
MboI	GATC	2 cut(s)	18, 112
MboII	GAAGA	3 cut(s)	136, 263, 305
MflI	RGATCY	1 cut(s)	112
MluCI	AATT	2 cut(s)	274, 279
MnlI	CCTC	4 cut(s)	135, 138, 234, 307
MseI	TTAA	2 cut(s)	216, 278
MwoI	GCNNNNNNNGC	1 cut(s)	242
NdeII	GATC	2 cut(s)	18, 112
NlaIII	CATG	1 cut(s)	181
NlaIV	GGNNCC	1 cut(s)	151
NmuCI	GTSAC	2 cut(s)	52, 166
PfeI	GAWTC	1 cut(s)	174
Ppu21I	YACGTR	1 cut(s)	9
PspN4I	GGNNCC	1 cut(s)	151
PspPI	GGNCC	2 cut(s)	150, 243
PsuI	RGATCY	1 cut(s)	112
SaqAI	TTAA	2 cut(s)	216, 278
Sau3AI	GATC	2 cut(s)	18, 112
Sau96I	GGNCC	2 cut(s)	150, 243
SetI	ASST	6 cut(s)	11, 121, 166, 187, 225, 259
Sse9I	AATT	2 cut(s)	274, 279
SsiI	CCGC	1 cut(s)	304
SspMI	CTAG	2 cut(s)	171, 287
TaiI	ACGT	1 cut(s)	11
TasI	AATT	2 cut(s)	274, 279
TfiI	GAWTC	1 cut(s)	174
Tru1I	TTAA	2 cut(s)	216, 278
Tru9I	TTAA	2 cut(s)	216, 278
TseFI	GTSAC	2 cut(s)	52, 166
Tsp45I	GTSAC	2 cut(s)	52, 166
TspDTI	ATGAA	2 cut(s)	93, 204
XagI	CCTNNNNNAGG	1 cut(s)	311
XapI	RAATTY	1 cut(s)	274
XspI	CTAG	2 cut(s)	171, 287

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.