Rmu_sc0003882.1_g000011

Belongs to the UDP-glycosyltransferase family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003882.1
OG0006957
Physical Location & Seq
Reverse (-)
42160 .. 42528
369 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003882.1_g000011.1.cds

Sequence Viewer

Length: 369 bp
atgactcattgtggttggaactctatccttaaaggagtggctgctggggtgccaatgatcacctggctagtgtctgcagaacaattctacaatgagaaattggtgactcagttgcttgggattggggttgctgttggggctgaaaagtgggatacatttgaggatgatagtctgaagagtgaagccagcgtgaagatggaggccatagagaaggctgtgactgaaatcatggtgggtgatgaagcagaggaaatgagaagcagagttaaagagcttggagagataggaaacaaggctgttgaagaaggcggttcatcgttctccgatttaactgctcttatagaagagttgaggttccttgggacctga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00906 ko01100 ko01110 map00906 map01100 map01110
Pfam Domains
Protein Families
UDPGT

Protein Analysis

122

Amino Acids

13.27

Weight (kDa)

4.45

Isoelectric Point (pI)

45.41

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 49
AciI CCGC 1 cut(s) 309
AcuI CTGAAG 1 cut(s) 194
AgsI TTSAA 1 cut(s) 302
AjnI CCWGG 1 cut(s) 62
AluBI AGCT 1 cut(s) 274
AluI AGCT 1 cut(s) 274
AoxI GGCC 1 cut(s) 201
ApeKI GCWGC 1 cut(s) 41
AspS9I GGNCC 1 cut(s) 363
AsuHPI GGTGA 3 cut(s) 52, 115, 248
AvaII GGWCC 1 cut(s) 363
BanI GGYRCC 1 cut(s) 49
BbvI GCAGC 1 cut(s) 28
BccI CCATC 1 cut(s) 190
BcgI CGANNNNNNTGC 2 cut(s) 314, 348
BciT130I CCWGG 1 cut(s) 64
BciVI GTATCC 1 cut(s) 145
BclI TGATCA 1 cut(s) 57
BfaI CTAG 1 cut(s) 68
BfmI CTRYAG 1 cut(s) 75
BfuI GTATCC 1 cut(s) 145
BisI GCNGC 1 cut(s) 42
BlsI GCNGC 1 cut(s) 43
Bme1390I CCNGG 1 cut(s) 64
Bme18I GGWCC 1 cut(s) 363
BmgT120I GGNCC 1 cut(s) 363
BmiI GGNNCC 3 cut(s) 51, 356, 364
BmrFI CCNGG 1 cut(s) 64
BsaJI CCNNGG 1 cut(s) 358
BseBI CCWGG 1 cut(s) 64
BseDI CCNNGG 1 cut(s) 358
BseGI GGATG 1 cut(s) 169
BseMII CTCAG 1 cut(s) 122
BseXI GCAGC 1 cut(s) 28
BseYI CCCAGC 1 cut(s) 44
BshFI GGCC 1 cut(s) 203
BshNI GGYRCC 1 cut(s) 49
BsnI GGCC 1 cut(s) 203
Bsp143I GATC 1 cut(s) 57
BspACI CCGC 1 cut(s) 309
BspANI GGCC 1 cut(s) 203
BspCNI CTCAG 1 cut(s) 121
BspLI GGNNCC 3 cut(s) 51, 356, 364
BspMAI CTGCAG 1 cut(s) 79
BspT107I GGYRCC 1 cut(s) 49
BssECI CCNNGG 1 cut(s) 358
BssMI GATC 1 cut(s) 57
BssT1I CCWWGG 1 cut(s) 358
Bst2UI CCWGG 1 cut(s) 64
Bst6I CTCTTC 2 cut(s) 170, 339
BstC8I GCNNGC 1 cut(s) 187
BstDEI CTNAG 1 cut(s) 108
BstF5I GGATG 1 cut(s) 169
BstKTI GATC 1 cut(s) 60
BstMBI GATC 1 cut(s) 57
BstMWI GCNNNNNNNGC 1 cut(s) 137
BstNI CCWGG 1 cut(s) 64
BstSCI CCNGG 1 cut(s) 62
BstSFI CTRYAG 1 cut(s) 75
BstV1I GCAGC 1 cut(s) 28
BsuI GTATCC 1 cut(s) 145
BsuRI GGCC 1 cut(s) 203
BtsCI GGATG 1 cut(s) 169
Cac8I GCNNGC 1 cut(s) 187
Cfr13I GGNCC 1 cut(s) 363
CviAII CATG 1 cut(s) 229
CviJI RGCY 8 cut(s) 41, 67, 140, 185, 203, 215, 274, 296
CviKI_1 RGCY 8 cut(s) 41, 67, 140, 185, 203, 215, 274, 296
DdeI CTNAG 1 cut(s) 108
DpnI GATC 1 cut(s) 59
DpnII GATC 1 cut(s) 57
Eam1104I CTCTTC 2 cut(s) 170, 339
EarI CTCTTC 2 cut(s) 170, 339
Eco130I CCWWGG 1 cut(s) 358
Eco47I GGWCC 1 cut(s) 363
Eco57I CTGAAG 1 cut(s) 194
EcoO109I RGGNCCY 1 cut(s) 363
EcoRII CCWGG 1 cut(s) 62
EcoT14I CCWWGG 1 cut(s) 358
ErhI CCWWGG 1 cut(s) 358
FaeI CATG 1 cut(s) 232
FaiI YATR 3 cut(s) 206, 230, 341
FatI CATG 1 cut(s) 228
FbaI TGATCA 1 cut(s) 57
Fnu4HI GCNGC 1 cut(s) 42
FokI GGATG 1 cut(s) 176
Fsp4HI GCNGC 1 cut(s) 42
FspBI CTAG 1 cut(s) 68
GluI GCNGC 1 cut(s) 42
GsaI CCCAGC 1 cut(s) 48
HaeIII GGCC 1 cut(s) 203
Hin1II CATG 1 cut(s) 232
HinfI GANTC 2 cut(s) 4, 106
HphI GGTGA 3 cut(s) 52, 115, 248
Hpy188I TCNGA 2 cut(s) 174, 325
HpyAV CCTTC 2 cut(s) 205, 299
HpyCH4V TGCA 1 cut(s) 77
HpyF10VI GCNNNNNNNGC 1 cut(s) 137
HpyF3I CTNAG 1 cut(s) 108
Hsp92II CATG 1 cut(s) 232
Ksp22I TGATCA 1 cut(s) 57
Kzo9I GATC 1 cut(s) 57
LpnPI CCDG 4 cut(s) 30, 49, 76, 199
Lsp1109I GCAGC 1 cut(s) 28
MaeI CTAG 1 cut(s) 68
MaeIII GTNAC 2 cut(s) 103, 217
MalI GATC 1 cut(s) 59
MboI GATC 1 cut(s) 57
MboII GAAGA 4 cut(s) 187, 205, 314, 356
MluCI AATT 2 cut(s) 83, 98
MlyI GAGTC 1 cut(s) 100
MnlI CCTC 4 cut(s) 154, 193, 241, 345
MseI TTAA 3 cut(s) 30, 267, 329
MspR9I CCNGG 1 cut(s) 64
MvaI CCWGG 1 cut(s) 64
MwoI GCNNNNNNNGC 1 cut(s) 137
NdeII GATC 1 cut(s) 57
NlaIII CATG 1 cut(s) 232
NlaIV GGNNCC 3 cut(s) 51, 356, 364
NmuCI GTSAC 2 cut(s) 103, 217
PkrI GCNGC 1 cut(s) 43
PleI GAGTC 1 cut(s) 100
PpsI GAGTC 1 cut(s) 100
PpuMI RGGWCCY 1 cut(s) 363
Psp5II RGGWCCY 1 cut(s) 363
Psp6I CCWGG 1 cut(s) 62
PspFI CCCAGC 1 cut(s) 44
PspGI CCWGG 1 cut(s) 62
PspN4I GGNNCC 3 cut(s) 51, 356, 364
PspPI GGNCC 1 cut(s) 363
PspPPI RGGWCCY 1 cut(s) 363
PstI CTGCAG 1 cut(s) 79
SaqAI TTAA 3 cut(s) 30, 267, 329
SatI GCNGC 1 cut(s) 42
Sau3AI GATC 1 cut(s) 57
Sau96I GGNCC 1 cut(s) 363
SchI GAGTC 1 cut(s) 100
ScrFI CCNGG 1 cut(s) 64
SetI ASST 4 cut(s) 65, 276, 356, 368
SfcI CTRYAG 1 cut(s) 75
SinI GGWCC 1 cut(s) 363
Sse9I AATT 2 cut(s) 83, 98
SsiI CCGC 1 cut(s) 309
SspMI CTAG 1 cut(s) 68
StyD4I CCNGG 1 cut(s) 62
StyI CCWWGG 1 cut(s) 358
TasI AATT 2 cut(s) 83, 98
Tru1I TTAA 3 cut(s) 30, 267, 329
Tru9I TTAA 3 cut(s) 30, 267, 329
TseFI GTSAC 2 cut(s) 103, 217
TseI GCWGC 1 cut(s) 41
Tsp45I GTSAC 2 cut(s) 103, 217
TspDTI ATGAA 2 cut(s) 255, 303
VpaK11BI GGWCC 1 cut(s) 363
XcmI CCANNNNNNNNNTGG 2 cut(s) 60, 193
XspI CTAG 1 cut(s) 68
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.