Rmu_sc0003137.1_g000004

AUX/IAA family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003137.1
Physical Location & Seq
Forward (+)
14423 .. 15296
874 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003137.1_g000004.1.cds

Sequence Viewer

Length: 564 bp
atggagcttcaactgggtttggctctgtcgcttccggttcatcagatcgctcctgtcaaagggtttgatgtaaccagtcatggggtgatgggcttggatttatggagctatggatgctgcttggagagcaaaaagaagcgcagtcacgacacggctttcgagaagattggaagtgacgatgagtcgaagatgttgcctttgtttttgtggtatggccagccggatgaggaagacgatgatggcaaggggcaaaagaaaagagactcttgcagtctcatcgataccaatgatgatggagaaggaaaccaagttgttgggtggccaccaattaaatcatggaggaagaagatgttttttcctgatcatcaacaccatggtcgtggccgccacgatctccagaatcatcagaatatagtggcaaaggaaaatgatgggccagaaaattccatgtacgtaaaggtgaagatggaaggagtgggaattctgaggaagatagatataaagctgcatcactcttatcagacacttagagactccttgatagccatgtttgccaaatgttag

Protein Analysis

187

Amino Acids

21.24

Weight (kDa)

6.35

Isoelectric Point (pI)

40.75

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 385
AcoI YGGCCR 3 cut(s) 214, 320, 382
AcsI RAATTY 2 cut(s) 442, 480
AfaI GTAC 1 cut(s) 452
AfiI CCNNNNNNNGG 2 cut(s) 59, 81
AgsI TTSAA 1 cut(s) 11
AhdI GACNNNNNGTC 1 cut(s) 181
AluBI AGCT 3 cut(s) 7, 108, 505
AluI AGCT 3 cut(s) 7, 108, 505
Alw26I GTCTC 3 cut(s) 255, 278, 525
AoxI GGCC 4 cut(s) 214, 320, 382, 434
ApeKI GCWGC 2 cut(s) 117, 505
ApoI RAATTY 2 cut(s) 442, 480
ArsI GACNNNNNNTTYG 2 cut(s) 140, 172
AspLEI GCGC 1 cut(s) 141
AspS9I GGNCC 1 cut(s) 434
AsuHPI GGTGA 2 cut(s) 97, 472
BalI TGGCCA 2 cut(s) 216, 322
BbsI GAAGAC 1 cut(s) 237
BbvI GCAGC 2 cut(s) 104, 492
BccI CCATC 5 cut(s) 82, 233, 287, 425, 460
BceAI ACGGC 1 cut(s) 168
BcgI CGANNNNNNTGC 4 cut(s) 175, 209, 259, 293
BclI TGATCA 1 cut(s) 361
BcoDI GTCTC 3 cut(s) 255, 278, 525
BisI GCNGC 3 cut(s) 118, 385, 506
BlsI GCNGC 3 cut(s) 119, 386, 507
BmeRI GACNNNNNGTC 1 cut(s) 181
BmgT120I GGNCC 1 cut(s) 434
BmrI ACTGGG 1 cut(s) 23
BmsI GCATC 2 cut(s) 104, 517
BmuI ACTGGG 1 cut(s) 23
BpiI GAAGAC 1 cut(s) 237
BpmI CTGGAG 1 cut(s) 380
Bsa29I ATCGAT 1 cut(s) 279
BsaAI YACGTR 1 cut(s) 454
BsaJI CCNNGG 1 cut(s) 373
BsaWI WCCGGW 1 cut(s) 34
Bsc4I CCNNNNNNNGG 2 cut(s) 59, 81
Bse1I ACTGG 2 cut(s) 18, 75
BseCI ATCGAT 1 cut(s) 279
BseDI CCNNGG 1 cut(s) 373
BseGI GGATG 2 cut(s) 119, 229
BseLI CCNNNNNNNGG 2 cut(s) 59, 81
BseMII CTCAG 1 cut(s) 476
BseNI ACTGG 2 cut(s) 18, 75
BseXI GCAGC 2 cut(s) 104, 492
BshFI GGCC 4 cut(s) 216, 322, 384, 436
BshVI ATCGAT 1 cut(s) 279
BsiSI CCGG 2 cut(s) 35, 221
BslI CCNNNNNNNGG 2 cut(s) 59, 81
BsmAI GTCTC 3 cut(s) 255, 278, 525
BsnI GGCC 4 cut(s) 216, 322, 384, 436
Bsp143I GATC 3 cut(s) 45, 361, 391
Bsp19I CCATGG 1 cut(s) 373
BspACI CCGC 1 cut(s) 385
BspANI GGCC 4 cut(s) 216, 322, 384, 436
BspCNI CTCAG 1 cut(s) 477
BspDI ATCGAT 1 cut(s) 279
BsrI ACTGG 2 cut(s) 18, 75
BssECI CCNNGG 1 cut(s) 373
BssMI GATC 3 cut(s) 45, 361, 391
BssT1I CCWWGG 1 cut(s) 373
BstBAI YACGTR 1 cut(s) 454
BstC8I GCNNGC 1 cut(s) 218
BstDEI CTNAG 2 cut(s) 485, 527
BstDSI CCRYGG 1 cut(s) 373
BstENI CCTNNNNNAGG 1 cut(s) 57
BstF5I GGATG 2 cut(s) 119, 229
BstHHI GCGC 1 cut(s) 141
BstKTI GATC 3 cut(s) 48, 364, 394
BstMAI GTCTC 3 cut(s) 255, 278, 525
BstMBI GATC 3 cut(s) 45, 361, 391
BstMWI GCNNNNNNNGC 3 cut(s) 114, 126, 551
BstSNI TACGTA 1 cut(s) 454
BstV1I GCAGC 2 cut(s) 104, 492
BstV2I GAAGAC 1 cut(s) 237
BstXI CCANNNNNNTGG 2 cut(s) 314, 380
Bsu15I ATCGAT 1 cut(s) 279
BsuRI GGCC 4 cut(s) 216, 322, 384, 436
BsuTUI ATCGAT 1 cut(s) 279
BtgI CCRYGG 1 cut(s) 373
BtsCI GGATG 2 cut(s) 119, 229
Cac8I GCNNGC 1 cut(s) 218
CfoI GCGC 1 cut(s) 141
Cfr13I GGNCC 1 cut(s) 434
ClaI ATCGAT 1 cut(s) 279
Csp6I GTAC 1 cut(s) 451
CviAII CATG 5 cut(s) 80, 336, 374, 448, 547
CviQI GTAC 1 cut(s) 451
DdeI CTNAG 2 cut(s) 485, 527
DpnI GATC 3 cut(s) 47, 363, 393
DpnII GATC 3 cut(s) 45, 361, 391
DriI GACNNNNNGTC 1 cut(s) 181
EaeI YGGCCR 3 cut(s) 214, 320, 382
Eam1105I GACNNNNNGTC 1 cut(s) 181
Eco105I TACGTA 1 cut(s) 454
Eco130I CCWWGG 1 cut(s) 373
EcoNI CCTNNNNNAGG 1 cut(s) 57
EcoRI GAATTC 1 cut(s) 480
EcoT14I CCWWGG 1 cut(s) 373
ErhI CCWWGG 1 cut(s) 373
FaeI CATG 5 cut(s) 83, 339, 377, 451, 550
FalI AAGNNNNNCTT 2 cut(s) 250, 282
FatI CATG 5 cut(s) 79, 335, 373, 447, 546
FbaI TGATCA 1 cut(s) 361
Fnu4HI GCNGC 3 cut(s) 118, 385, 506
FokI GGATG 2 cut(s) 126, 236
Fsp4HI GCNGC 3 cut(s) 118, 385, 506
GlaI GCGC 1 cut(s) 140
GluI GCNGC 3 cut(s) 118, 385, 506
GsuI CTGGAG 1 cut(s) 380
HaeIII GGCC 4 cut(s) 216, 322, 384, 436
HapII CCGG 2 cut(s) 35, 221
HhaI GCGC 1 cut(s) 141
Hin1II CATG 5 cut(s) 83, 339, 377, 451, 550
Hin6I GCGC 1 cut(s) 139
HinP1I GCGC 1 cut(s) 139
HinfI GANTC 4 cut(s) 182, 263, 400, 533
HpaII CCGG 2 cut(s) 35, 221
HphI GGTGA 2 cut(s) 97, 472
Hpy188I TCNGA 4 cut(s) 45, 408, 486, 522
Hpy188III TCNNGA 4 cut(s) 146, 160, 359, 397
HpyAV CCTTC 2 cut(s) 293, 464
HpyCH4IV ACGT 1 cut(s) 453
HpyCH4V TGCA 2 cut(s) 270, 508
HpyF10VI GCNNNNNNNGC 3 cut(s) 114, 126, 551
HpyF3I CTNAG 2 cut(s) 485, 527
HpySE526I ACGT 1 cut(s) 453
Hsp92II CATG 5 cut(s) 83, 339, 377, 451, 550
HspAI GCGC 1 cut(s) 139
Ksp22I TGATCA 1 cut(s) 361
Kzo9I GATC 3 cut(s) 45, 361, 391
LmnI GCTCC 3 cut(s) 4, 55, 105
LpnPI CCDG 8 cut(s) 48, 66, 88, 230, 234, 372, 410, 450
Lsp1109I GCAGC 2 cut(s) 104, 492
LweI GCATC 2 cut(s) 104, 517
MaeII ACGT 1 cut(s) 453
MaeIII GTNAC 3 cut(s) 70, 143, 173
MalI GATC 3 cut(s) 47, 363, 393
MboI GATC 3 cut(s) 45, 361, 391
MboII GAAGA 7 cut(s) 175, 199, 242, 355, 358, 475, 502
MlsI TGGCCA 2 cut(s) 216, 322
MluCI AATT 3 cut(s) 327, 442, 480
MluNI TGGCCA 2 cut(s) 216, 322
MlyI GAGTC 3 cut(s) 191, 257, 527
MnlI CCTC 3 cut(s) 220, 333, 480
Mox20I TGGCCA 2 cut(s) 216, 322
MscI TGGCCA 2 cut(s) 216, 322
MseI TTAA 1 cut(s) 330
MslI CAYNNNNRTG 1 cut(s) 378
Msp20I TGGCCA 2 cut(s) 216, 322
MspI CCGG 2 cut(s) 35, 221
MwoI GCNNNNNNNGC 3 cut(s) 114, 126, 551
NcoI CCATGG 1 cut(s) 373
NdeII GATC 3 cut(s) 45, 361, 391
NlaIII CATG 5 cut(s) 83, 339, 377, 451, 550
NmuCI GTSAC 2 cut(s) 143, 173
PfeI GAWTC 1 cut(s) 400
PkrI GCNGC 3 cut(s) 119, 386, 507
PleI GAGTC 3 cut(s) 190, 257, 527
PpsI GAGTC 3 cut(s) 190, 257, 527
Ppu21I YACGTR 1 cut(s) 454
PspPI GGNCC 1 cut(s) 434
RsaI GTAC 1 cut(s) 452
RsaNI GTAC 1 cut(s) 451
RseI CAYNNNNRTG 1 cut(s) 378
SaqAI TTAA 1 cut(s) 330
SatI GCNGC 3 cut(s) 118, 385, 506
Sau3AI GATC 3 cut(s) 45, 361, 391
Sau96I GGNCC 1 cut(s) 434
SchI GAGTC 3 cut(s) 191, 257, 527
SetI ASST 5 cut(s) 9, 110, 456, 462, 507
SfaNI GCATC 2 cut(s) 104, 517
SmiMI CAYNNNNRTG 1 cut(s) 378
SnaBI TACGTA 1 cut(s) 454
Sse9I AATT 3 cut(s) 327, 442, 480
SsiI CCGC 1 cut(s) 385
StyI CCWWGG 1 cut(s) 373
TaiI ACGT 1 cut(s) 456
TaqI TCGA 3 cut(s) 159, 185, 279
TasI AATT 3 cut(s) 327, 442, 480
TauI GCSGC 1 cut(s) 387
TfiI GAWTC 1 cut(s) 400
Tru1I TTAA 1 cut(s) 330
Tru9I TTAA 1 cut(s) 330
TseFI GTSAC 2 cut(s) 143, 173
TseI GCWGC 2 cut(s) 117, 505
Tsp45I GTSAC 2 cut(s) 143, 173
TspDTI ATGAA 1 cut(s) 29
XagI CCTNNNNNAGG 1 cut(s) 57
XapI RAATTY 2 cut(s) 442, 480
XcmI CCANNNNNNNNNTGG 1 cut(s) 333
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.