Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0003649.1

Orthogroup ID

OG0003493

Physical Location & Seq

Genomic Coordinates Reverse (-)

84692 .. 85583

Gene Structure 892 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0003649.1_g000016.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 657 bp

atgcatgagatggttccagggaaacgttttgatcgttaccacgaattgggtcagcatgcatttggtgaaaagcttggtctttacattgtggtgcttcagcaactcattgttgaagttggtgtttgcattgtgtacatggtcaccggaggaaaatctctgcagaaggtccatgacactgcgggctcagactgcaaaaagattaaattgacttacttcatcatgatctttgcctctgttcactttgtgctttcccaccttcccaacttcaactccatctccggcgtgtctttggccgcagctgtcatgtccttgagttactctaccatagcatggactgctgcggtagacaagggtgtggtagaaaatgttgattatggttacaaagccaagactactacaggaaattttttcaacttcttagctgcattgggtgaagtggcttttgcgtatgctggccataatgtagtcctcgaaatccaaacaacaattccttctacacctgagaagccttccaagatacctatgtggaatggagtcattgttgcctacataattgtggctttgtgctacttcccagttgctctagtaggatattacatatatggaaattcagttgatgacaacatctcgtctcattggaaagacccaaatggctaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Aa_trans

Protein Analysis

218

Amino Acids

23.92

Weight (kDa)

6.69

Isoelectric Point (pI)

16.55

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003493)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G48640 AT5G40780 AT5G40780 AT5G40780
fragaria_vesca	FvH4_6g52810 FvH4_6g52810
malus_domestica	MD09G1016600.v1.1 MD17G1017000.v1.1
prunus_persica	Prupe.3G300900_v2.0.a1
pyrus_communis	pycom111g01350 pycom17g01370
rosa_chinensis	RchiOBHm_Chr2g0174431 RchiOBHm_Chr2g0174471 RchiOBHm_Chr2g0174481 RchiOBHm_Chr2g0174521
rosa_laevigata	RLG00000014785 RLG00000022265 RLG00000022271
rosa_multiflora	Rmu_sc0001533.1_g000014 Rmu_sc0003649.1_g000016 Rmu_sc0003649.1_g000022 Rmu_sc0003649.1_g000026
rosa_roxburghii	Rroxscaffold_2G00078090 Rroxscaffold_2G00078200 Rroxscaffold_7G00209460
rosa_rugosa	Rorug02G0577100 Rorug02G0577200 Rorug05G0563500
rosa_samantha	Rh2BG669100 Rh2CG632000 Rh2CG632300 Rh2DG683000
rosa_wichuraiana	Rw2G053890 Rw2G053900 Rw6G007230

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	2 cut(s)	46, 330
AccI	GTMKAC	1 cut(s)	345
AciI	CCGC	3 cut(s)	179, 294, 341
AclI	AACGTT	1 cut(s)	25
AcoI	YGGCCR	2 cut(s)	291, 454
AcsI	RAATTY	2 cut(s)	403, 607
AcuI	CTGAAG	1 cut(s)	80
AdeI	CACNNNGTG	1 cut(s)	244
AfaI	GTAC	1 cut(s)	134
AfiI	CCNNNNNNNGG	2 cut(s)	46, 330
AgsI	TTSAA	3 cut(s)	113, 268, 412
AjnI	CCWGG	1 cut(s)	16
AjuI	GAANNNNNNNTTGG	2 cut(s)	471, 503
AluBI	AGCT	3 cut(s)	73, 299, 422
AluI	AGCT	3 cut(s)	73, 299, 422
Alw26I	GTCTC	1 cut(s)	636
AoxI	GGCC	2 cut(s)	291, 454
ApeKI	GCWGC	3 cut(s)	296, 338, 422
ApoI	RAATTY	2 cut(s)	403, 607
AspS9I	GGNCC	1 cut(s)	166
AsuHPI	GGTGA	3 cut(s)	77, 133, 443
AvaII	GGWCC	1 cut(s)	166
BaeI	ACNNNNGTAYC	2 cut(s)	509, 542
BalI	TGGCCA	1 cut(s)	456
BanII	GRGCYC	1 cut(s)	185
BbvI	GCAGC	3 cut(s)	308, 325, 409
BccI	CCATC	2 cut(s)	4, 281
BciT130I	CCWGG	1 cut(s)	18
BcoDI	GTCTC	1 cut(s)	636
BfaI	CTAG	1 cut(s)	584
BfmI	CTRYAG	2 cut(s)	158, 396
BisI	GCNGC	4 cut(s)	294, 297, 339, 423
BlsI	GCNGC	4 cut(s)	295, 298, 340, 424
Bme1390I	CCNGG	1 cut(s)	18
Bme18I	GGWCC	1 cut(s)	166
BmgT120I	GGNCC	1 cut(s)	166
BmiI	GGNNCC	1 cut(s)	15
BmrFI	CCNGG	1 cut(s)	18
BmrI	ACTGGG	1 cut(s)	569
BmuI	ACTGGG	1 cut(s)	569
BpuEI	CTTGAG	1 cut(s)	331
BsaJI	CCNNGG	1 cut(s)	17
BsaWI	WCCGGW	1 cut(s)	143
BsaXI	ACNNNNNCTCC	6 cut(s)	254, 260, 284, 290, 525, 555
Bsc4I	CCNNNNNNNGG	2 cut(s)	46, 330
Bse1I	ACTGG	1 cut(s)	575
BseBI	CCWGG	1 cut(s)	18
BseDI	CCNNGG	1 cut(s)	17
BseLI	CCNNNNNNNGG	2 cut(s)	46, 330
BseMII	CTCAG	2 cut(s)	198, 492
BseNI	ACTGG	1 cut(s)	575
BseXI	GCAGC	3 cut(s)	308, 325, 409
BshFI	GGCC	2 cut(s)	293, 456
BsiSI	CCGG	2 cut(s)	144, 279
BslI	CCNNNNNNNGG	2 cut(s)	46, 330
BsmAI	GTCTC	1 cut(s)	636
BsmBI	CGTCTC	1 cut(s)	636
BsnI	GGCC	2 cut(s)	293, 456
Bsp1286I	GDGCHC	1 cut(s)	185
Bsp1407I	TGTACA	1 cut(s)	132
Bsp143I	GATC	2 cut(s)	31, 222
BspACI	CCGC	3 cut(s)	179, 294, 341
BspANI	GGCC	2 cut(s)	293, 456
BspCNI	CTCAG	2 cut(s)	197, 493
BspHI	TCATGA	1 cut(s)	219
BspLI	GGNNCC	1 cut(s)	15
BspMAI	CTGCAG	1 cut(s)	162
BsrGI	TGTACA	1 cut(s)	132
BsrI	ACTGG	1 cut(s)	575
BssECI	CCNNGG	1 cut(s)	17
BssMI	GATC	2 cut(s)	31, 222
Bst2UI	CCWGG	1 cut(s)	18
BstAPI	GCANNNNNTGC	1 cut(s)	335
BstAUI	TGTACA	1 cut(s)	132
BstC8I	GCNNGC	3 cut(s)	57, 181, 454
BstDEI	CTNAG	3 cut(s)	184, 418, 501
BstEII	GGTNACC	1 cut(s)	139
BstKTI	GATC	2 cut(s)	34, 225
BstMAI	GTCTC	1 cut(s)	636
BstMBI	GATC	2 cut(s)	31, 222
BstMWI	GCNNNNNNNGC	2 cut(s)	189, 335
BstNI	CCWGG	1 cut(s)	18
BstNSI	RCATGY	1 cut(s)	59
BstPI	GGTNACC	1 cut(s)	139
BstSCI	CCNGG	1 cut(s)	16
BstSFI	CTRYAG	2 cut(s)	158, 396
BstV1I	GCAGC	3 cut(s)	308, 325, 409
BsuRI	GGCC	2 cut(s)	293, 456
BtsI	GCAGTG	1 cut(s)	174
BtsIMutI	CAGTG	1 cut(s)	174
Cac8I	GCNNGC	3 cut(s)	57, 181, 454
CciI	TCATGA	1 cut(s)	219
Cfr13I	GGNCC	1 cut(s)	166
Csp6I	GTAC	1 cut(s)	133
CviAII	CATG	7 cut(s)	5, 56, 136, 170, 220, 304, 330
CviQI	GTAC	1 cut(s)	133
DdeI	CTNAG	3 cut(s)	184, 418, 501
DpnI	GATC	2 cut(s)	33, 224
DpnII	GATC	2 cut(s)	31, 222
DraIII	CACNNNGTG	1 cut(s)	244
EaeI	YGGCCR	2 cut(s)	291, 454
Eco24I	GRGCYC	1 cut(s)	185
Eco47I	GGWCC	1 cut(s)	166
Eco57I	CTGAAG	1 cut(s)	80
Eco91I	GGTNACC	1 cut(s)	139
EcoO65I	GGTNACC	1 cut(s)	139
EcoRII	CCWGG	1 cut(s)	16
EcoT22I	ATGCAT	2 cut(s)	6, 61
EcoT38I	GRGCYC	1 cut(s)	185
Esp3I	CGTCTC	1 cut(s)	636
FaeI	CATG	7 cut(s)	8, 59, 139, 173, 223, 307, 333
FatI	CATG	7 cut(s)	4, 55, 135, 169, 219, 303, 329
FauI	CCCGC	1 cut(s)	172
FblI	GTMKAC	1 cut(s)	345
Fnu4HI	GCNGC	4 cut(s)	294, 297, 339, 423
FriOI	GRGCYC	1 cut(s)	185
Fsp4HI	GCNGC	4 cut(s)	294, 297, 339, 423
FspBI	CTAG	1 cut(s)	584
GluI	GCNGC	4 cut(s)	294, 297, 339, 423
HaeIII	GGCC	2 cut(s)	293, 456
HapII	CCGG	2 cut(s)	144, 279
Hin1II	CATG	7 cut(s)	8, 59, 139, 173, 223, 307, 333
HindIII	AAGCTT	1 cut(s)	71
HinfI	GANTC	1 cut(s)	534
HpaII	CCGG	2 cut(s)	144, 279
HphI	GGTGA	3 cut(s)	77, 133, 443
Hpy166II	GTNNAC	3 cut(s)	133, 238, 346
Hpy188I	TCNGA	1 cut(s)	187
Hpy188III	TCNNGA	1 cut(s)	220
Hpy8I	GTNNAC	3 cut(s)	133, 238, 346
HpyAV	CCTTC	4 cut(s)	157, 266, 501, 519
HpyCH4IV	ACGT	1 cut(s)	25
HpyCH4V	TGCA	6 cut(s)	4, 59, 126, 160, 192, 425
HpyF10VI	GCNNNNNNNGC	2 cut(s)	189, 335
HpyF3I	CTNAG	3 cut(s)	184, 418, 501
HpySE526I	ACGT	1 cut(s)	25
Hsp92II	CATG	7 cut(s)	8, 59, 139, 173, 223, 307, 333
Kzo9I	GATC	2 cut(s)	31, 222
LpnPI	CCDG	8 cut(s)	3, 30, 157, 292, 384, 438, 513, 588
Lsp1109I	GCAGC	3 cut(s)	308, 325, 409
MaeI	CTAG	1 cut(s)	584
MaeII	ACGT	1 cut(s)	25
MaeIII	GTNAC	4 cut(s)	35, 139, 314, 377
MalI	GATC	2 cut(s)	33, 224
MboI	GATC	2 cut(s)	31, 222
MhlI	GDGCHC	1 cut(s)	185
MlsI	TGGCCA	1 cut(s)	456
MluCI	AATT	6 cut(s)	44, 203, 403, 486, 552, 607
MluNI	TGGCCA	1 cut(s)	456
MlyI	GAGTC	1 cut(s)	543
MnlI	CCTC	3 cut(s)	140, 241, 479
Mox20I	TGGCCA	1 cut(s)	456
Mph1103I	ATGCAT	2 cut(s)	6, 61
MscI	TGGCCA	1 cut(s)	456
MseI	TTAA	1 cut(s)	201
MslI	CAYNNNNRTG	2 cut(s)	89, 554
Msp20I	TGGCCA	1 cut(s)	456
MspA1I	CMGCKG	1 cut(s)	299
MspI	CCGG	2 cut(s)	144, 279
MspR9I	CCNGG	1 cut(s)	18
MvaI	CCWGG	1 cut(s)	18
MwoI	GCNNNNNNNGC	2 cut(s)	189, 335
NdeII	GATC	2 cut(s)	31, 222
NlaIII	CATG	7 cut(s)	8, 59, 139, 173, 223, 307, 333
NlaIV	GGNNCC	1 cut(s)	15
NmuCI	GTSAC	1 cut(s)	139
NsiI	ATGCAT	2 cut(s)	6, 61
NspI	RCATGY	1 cut(s)	59
PaeI	GCATGC	1 cut(s)	59
PagI	TCATGA	1 cut(s)	219
PcsI	WCGNNNNNNNCGW	1 cut(s)	31
PflMI	CCANNNNNTGG	2 cut(s)	46, 330
PkrI	GCNGC	4 cut(s)	295, 298, 340, 424
PleI	GAGTC	1 cut(s)	542
PpsI	GAGTC	1 cut(s)	542
Psp1406I	AACGTT	1 cut(s)	25
Psp6I	CCWGG	1 cut(s)	16
PspEI	GGTNACC	1 cut(s)	139
PspGI	CCWGG	1 cut(s)	16
PspN4I	GGNNCC	1 cut(s)	15
PspPI	GGNCC	1 cut(s)	166
PstI	CTGCAG	1 cut(s)	162
PvuII	CAGCTG	1 cut(s)	299
RsaI	GTAC	1 cut(s)	134
RsaNI	GTAC	1 cut(s)	133
RseI	CAYNNNNRTG	2 cut(s)	89, 554
SaqAI	TTAA	1 cut(s)	201
SatI	GCNGC	4 cut(s)	294, 297, 339, 423
Sau3AI	GATC	2 cut(s)	31, 222
Sau96I	GGNCC	1 cut(s)	166
SchI	GAGTC	1 cut(s)	543
ScrFI	CCNGG	1 cut(s)	18
SduI	GDGCHC	1 cut(s)	185
SetI	ASST	8 cut(s)	28, 75, 168, 258, 301, 424, 502, 523
SfcI	CTRYAG	2 cut(s)	158, 396
SinI	GGWCC	1 cut(s)	166
SmiMI	CAYNNNNRTG	2 cut(s)	89, 554
SmlI	CTYRAG	1 cut(s)	310
SmoI	CTYRAG	1 cut(s)	310
SphI	GCATGC	1 cut(s)	59
Sse9I	AATT	6 cut(s)	44, 203, 403, 486, 552, 607
SsiI	CCGC	3 cut(s)	179, 294, 341
SspMI	CTAG	1 cut(s)	584
StyD4I	CCNGG	1 cut(s)	16
TaiI	ACGT	1 cut(s)	28
TaqI	TCGA	1 cut(s)	471
TasI	AATT	6 cut(s)	44, 203, 403, 486, 552, 607
TatI	WGTACW	1 cut(s)	132
TauI	GCSGC	1 cut(s)	296
Tru1I	TTAA	1 cut(s)	201
Tru9I	TTAA	1 cut(s)	201
TscAI	CASTG	1 cut(s)	181
TseFI	GTSAC	1 cut(s)	139
TseI	GCWGC	3 cut(s)	296, 338, 422
Tsp45I	GTSAC	1 cut(s)	139
TspDTI	ATGAA	1 cut(s)	205
TspRI	CASTG	1 cut(s)	181
Van91I	CCANNNNNTGG	2 cut(s)	46, 330
VpaK11BI	GGWCC	1 cut(s)	166
XapI	RAATTY	2 cut(s)	403, 607
XceI	RCATGY	1 cut(s)	59
XmiI	GTMKAC	1 cut(s)	345
XspI	CTAG	1 cut(s)	584
Zsp2I	ATGCAT	2 cut(s)	6, 61

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.