Rmu_sc0003893.1_g000002

Cyclic nucleotide-gated ion channel 1-like

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003893.1
Physical Location & Seq
Forward (+)
14912 .. 16778
1867 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003893.1_g000002.1.cds

Sequence Viewer

Length: 417 bp
atggacaagaagttaagggatgtagttcttgcattgcgatcacttacagatctcgctttcgcactccatactgatgctcagattcgtgatctgactgacgtgccctccgaccccttcgactttgagtatgaggatatcgtgtatcggggtttaaagtggatatctctagatatcataatcgaggtccttcctattcttcccatccaacaggtcatactagtagctatatttttcagaatgaatgattctggatatctaaatgaagcagcaactggcaacgtttttcttactttgcaattaattgcaaggggttgccaaatctaccacttctggaagccatttaaaagggttggaaaatgggccataagtgcattctttatcctcatgtacatcttggttggccatgtaagtttatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

138

Amino Acids

15.9

Weight (kDa)

5.84

Isoelectric Point (pI)

30.1

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclI AACGTT 1 cut(s) 279
AcoI YGGCCR 1 cut(s) 400
AfaI GTAC 1 cut(s) 389
AhlI ACTAGT 1 cut(s) 217
AjiI CACGTC 1 cut(s) 100
AluBI AGCT 1 cut(s) 224
AluI AGCT 1 cut(s) 224
AlwNI CAGNNNCTG 1 cut(s) 272
AoxI GGCC 2 cut(s) 360, 400
ApeKI GCWGC 1 cut(s) 266
AseI ATTAAT 1 cut(s) 299
AspS9I GGNCC 2 cut(s) 184, 360
AvaII GGWCC 1 cut(s) 184
BaeGI GKGCMC 1 cut(s) 105
BalI TGGCCA 1 cut(s) 402
BbvI GCAGC 1 cut(s) 278
BccI CCATC 1 cut(s) 209
BcuI ACTAGT 1 cut(s) 217
BfaI CTAG 2 cut(s) 167, 218
BglII AGATCT 1 cut(s) 49
BisI GCNGC 1 cut(s) 267
BlsI GCNGC 1 cut(s) 268
Bme18I GGWCC 1 cut(s) 184
BmgBI CACGTC 1 cut(s) 100
BmgT120I GGNCC 2 cut(s) 184, 360
BmsI GCATC 1 cut(s) 64
BsaXI ACNNNNNCTCC 2 cut(s) 89, 119
Bse1I ACTGG 1 cut(s) 277
Bse3DI GCAATG 1 cut(s) 32
BseGI GGATG 2 cut(s) 25, 201
BseMI GCAATG 1 cut(s) 32
BseMII CTCAG 1 cut(s) 92
BseNI ACTGG 1 cut(s) 277
BseSI GKGCMC 1 cut(s) 105
BseXI GCAGC 1 cut(s) 278
BshFI GGCC 2 cut(s) 362, 402
BsmI GAATGC 1 cut(s) 371
BsnI GGCC 2 cut(s) 362, 402
Bsp1286I GDGCHC 1 cut(s) 105
Bsp1407I TGTACA 1 cut(s) 387
Bsp143I GATC 3 cut(s) 38, 49, 88
BspANI GGCC 2 cut(s) 362, 402
BspCNI CTCAG 1 cut(s) 91
BsrDI GCAATG 1 cut(s) 32
BsrGI TGTACA 1 cut(s) 387
BsrI ACTGG 1 cut(s) 277
BssMI GATC 3 cut(s) 38, 49, 88
BstAUI TGTACA 1 cut(s) 387
BstDEI CTNAG 1 cut(s) 78
BstF5I GGATG 2 cut(s) 25, 201
BstKTI GATC 3 cut(s) 41, 52, 91
BstMBI GATC 3 cut(s) 38, 49, 88
BstMWI GCNNNNNNNGC 1 cut(s) 368
BstSLI GKGCMC 1 cut(s) 105
BstV1I GCAGC 1 cut(s) 278
BstX2I RGATCY 1 cut(s) 49
BstYI RGATCY 1 cut(s) 49
BsuRI GGCC 2 cut(s) 362, 402
BtrI CACGTC 1 cut(s) 100
BtsCI GGATG 2 cut(s) 25, 201
CaiI CAGNNNCTG 1 cut(s) 272
Cfr13I GGNCC 2 cut(s) 184, 360
Csp6I GTAC 1 cut(s) 388
CviAII CATG 2 cut(s) 385, 404
CviJI RGCY 4 cut(s) 224, 337, 362, 402
CviKI_1 RGCY 4 cut(s) 224, 337, 362, 402
CviQI GTAC 1 cut(s) 388
DdeI CTNAG 1 cut(s) 78
DpnI GATC 3 cut(s) 40, 51, 90
DpnII GATC 3 cut(s) 38, 49, 88
DraI TTTAAA 2 cut(s) 153, 343
EaeI YGGCCR 1 cut(s) 400
Eco32I GATATC 4 cut(s) 136, 162, 172, 254
Eco47I GGWCC 1 cut(s) 184
EcoO109I RGGNCCY 1 cut(s) 184
EcoRV GATATC 4 cut(s) 136, 162, 172, 254
FaeI CATG 2 cut(s) 388, 407
FaiI YATR 9 cut(s) 69, 129, 176, 215, 227, 365, 386, 405, 415
FatI CATG 2 cut(s) 384, 403
Fnu4HI GCNGC 1 cut(s) 267
FokI GGATG 2 cut(s) 32, 188
Fsp4HI GCNGC 1 cut(s) 267
FspBI CTAG 2 cut(s) 167, 218
GluI GCNGC 1 cut(s) 267
HaeIII GGCC 2 cut(s) 362, 402
Hin1II CATG 2 cut(s) 388, 407
HinfI GANTC 2 cut(s) 82, 245
Hpy188I TCNGA 4 cut(s) 81, 93, 109, 236
Hpy188III TCNNGA 4 cut(s) 86, 167, 249, 331
HpyAV CCTTC 2 cut(s) 124, 197
HpyCH4IV ACGT 2 cut(s) 99, 279
HpyCH4V TGCA 4 cut(s) 32, 295, 305, 371
HpyF10VI GCNNNNNNNGC 1 cut(s) 368
HpyF3I CTNAG 1 cut(s) 78
HpySE526I ACGT 2 cut(s) 99, 279
Hsp92II CATG 2 cut(s) 388, 407
Kzo9I GATC 3 cut(s) 38, 49, 88
LpnPI CCDG 4 cut(s) 194, 234, 258, 316
Lsp1109I GCAGC 1 cut(s) 278
LweI GCATC 1 cut(s) 64
MaeI CTAG 2 cut(s) 167, 218
MaeII ACGT 2 cut(s) 99, 279
MalI GATC 3 cut(s) 40, 51, 90
MboI GATC 3 cut(s) 38, 49, 88
MboII GAAGA 1 cut(s) 188
MflI RGATCY 1 cut(s) 49
MhlI GDGCHC 1 cut(s) 105
MlsI TGGCCA 1 cut(s) 402
MluCI AATT 2 cut(s) 296, 300
MluNI TGGCCA 1 cut(s) 402
MmeI TCCRAC 3 cut(s) 132, 229, 331
MnlI CCTC 4 cut(s) 115, 124, 175, 392
Mox20I TGGCCA 1 cut(s) 402
MscI TGGCCA 1 cut(s) 402
MseI TTAA 4 cut(s) 14, 152, 299, 342
MslI CAYNNNNRTG 1 cut(s) 72
Msp20I TGGCCA 1 cut(s) 402
Mva1269I GAATGC 1 cut(s) 371
MwoI GCNNNNNNNGC 1 cut(s) 368
NdeII GATC 3 cut(s) 38, 49, 88
NlaIII CATG 2 cut(s) 388, 407
PcsI WCGNNNNNNNCGW 1 cut(s) 105
PctI GAATGC 1 cut(s) 371
PfeI GAWTC 2 cut(s) 82, 245
PkrI GCNGC 1 cut(s) 268
PpuMI RGGWCCY 1 cut(s) 184
PshBI ATTAAT 1 cut(s) 299
Psp1406I AACGTT 1 cut(s) 279
Psp5II RGGWCCY 1 cut(s) 184
PspPI GGNCC 2 cut(s) 184, 360
PspPPI RGGWCCY 1 cut(s) 184
PstNI CAGNNNCTG 1 cut(s) 272
PsuI RGATCY 1 cut(s) 49
RsaI GTAC 1 cut(s) 389
RsaNI GTAC 1 cut(s) 388
RseI CAYNNNNRTG 1 cut(s) 72
SaqAI TTAA 4 cut(s) 14, 152, 299, 342
SatI GCNGC 1 cut(s) 267
Sau3AI GATC 3 cut(s) 38, 49, 88
Sau96I GGNCC 2 cut(s) 184, 360
SduI GDGCHC 1 cut(s) 105
SetI ASST 5 cut(s) 102, 186, 213, 226, 282
SfaNI GCATC 1 cut(s) 64
SinI GGWCC 1 cut(s) 184
SmiMI CAYNNNNRTG 1 cut(s) 72
SpeI ACTAGT 1 cut(s) 217
Sse9I AATT 2 cut(s) 296, 300
SspMI CTAG 2 cut(s) 167, 218
TaiI ACGT 2 cut(s) 102, 282
TaqI TCGA 2 cut(s) 117, 180
TasI AATT 2 cut(s) 296, 300
TatI WGTACW 1 cut(s) 387
TfiI GAWTC 2 cut(s) 82, 245
Tru1I TTAA 4 cut(s) 14, 152, 299, 342
Tru9I TTAA 4 cut(s) 14, 152, 299, 342
TseI GCWGC 1 cut(s) 266
TspDTI ATGAA 2 cut(s) 254, 276
VpaK11BI GGWCC 1 cut(s) 184
VspI ATTAAT 1 cut(s) 299
XbaI TCTAGA 1 cut(s) 166
XspI CTAG 2 cut(s) 167, 218
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.