Rroxscaffold_159G00432990

Cyclic nucleotide-gated ion channel 1-like

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000159
Physical Location & Seq
Reverse (-)
707432 .. 716863
9432 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_159G00432990.1

Sequence Viewer

Length: 234 bp
ATGGGAAATGTGCAGACATATATTTTGTGGGAAACTCAACAAGCATTGGACAATGAGAAGGAGAAAATTAAATCCAAATTTGAAGCTCTAGGTACATGGATGGTAAGAAATGGTATCCCCGAAGAAGTGAAGACCGAAGCAGTGAAAATCATAACGGAAAAGGAAGTAGTGGAGAAAAACTACGATGCTGATGTGGACTTGCTTTTTGTTTTCAATGCTCTTACTTGGGGATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

77

Amino Acids

8.91

Weight (kDa)

4.61

Isoelectric Point (pI)

18.22

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 77
AfaI GTAC 1 cut(s) 94
AgsI TTSAA 2 cut(s) 83, 214
AluBI AGCT 1 cut(s) 86
AluI AGCT 1 cut(s) 86
ApoI RAATTY 1 cut(s) 77
ArsI GACNNNNNNTTYG 4 cut(s) 7, 39, 188, 220
BbsI GAAGAC 1 cut(s) 137
BccI CCATC 1 cut(s) 94
BciVI GTATCC 1 cut(s) 125
BfaI CTAG 1 cut(s) 89
BfuI GTATCC 1 cut(s) 125
BmsI GCATC 1 cut(s) 175
BpiI GAAGAC 1 cut(s) 137
BseGI GGATG 1 cut(s) 105
BsgI GTGCAG 1 cut(s) 32
BstF5I GGATG 1 cut(s) 105
BstV2I GAAGAC 1 cut(s) 137
BsuI GTATCC 1 cut(s) 125
BtsCI GGATG 1 cut(s) 105
BtsI GCAGTG 1 cut(s) 147
BtsIMutI CAGTG 1 cut(s) 147
Csp6I GTAC 1 cut(s) 93
CviAII CATG 1 cut(s) 96
CviJI RGCY 1 cut(s) 86
CviKI_1 RGCY 1 cut(s) 86
CviQI GTAC 1 cut(s) 93
FaeI CATG 1 cut(s) 99
FaiI YATR 4 cut(s) 19, 21, 97, 152
FatI CATG 1 cut(s) 95
FokI GGATG 1 cut(s) 112
FspBI CTAG 1 cut(s) 89
Hin1II CATG 1 cut(s) 99
Hpy166II GTNNAC 1 cut(s) 196
Hpy8I GTNNAC 1 cut(s) 196
HpyAV CCTTC 1 cut(s) 52
HpyCH4V TGCA 1 cut(s) 13
Hsp92II CATG 1 cut(s) 99
LweI GCATC 1 cut(s) 175
MaeI CTAG 1 cut(s) 89
MboII GAAGA 2 cut(s) 134, 142
MluCI AATT 2 cut(s) 66, 77
MseI TTAA 1 cut(s) 69
NlaIII CATG 1 cut(s) 99
RsaI GTAC 1 cut(s) 94
RsaNI GTAC 1 cut(s) 93
SaqAI TTAA 1 cut(s) 69
SetI ASST 2 cut(s) 88, 94
SfaNI GCATC 1 cut(s) 175
SgeI CNNG 5 cut(s) 53, 101, 108, 131, 211
Sse9I AATT 2 cut(s) 66, 77
SspMI CTAG 1 cut(s) 89
TaqII GACCGA 1 cut(s) 149
TasI AATT 2 cut(s) 66, 77
Tru1I TTAA 1 cut(s) 69
Tru9I TTAA 1 cut(s) 69
TscAI CASTG 1 cut(s) 147
TspGWI ACGGA 1 cut(s) 170
TspRI CASTG 1 cut(s) 147
XapI RAATTY 1 cut(s) 77
XspI CTAG 1 cut(s) 89
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.