Rroxscaffold_4G00325310

Cyclic nucleotide-gated ion channel 1-like

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000004
Physical Location & Seq
Forward (+)
57036868 .. 57046054
9187 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_4G00325310.1

Sequence Viewer

Length: 258 bp
ATGGGAAATGTGCAGACATATATTTTGTGGGAAACTCAACAAGCATTGGACAATGAGAAGGAGAAAATTAAATCCAAATTTGAAGCTCTAGGTACATGGATGGTAAGAAATGGTATCCCCGAAGAAGTGAAGACCGAAGCAGTGAAAATCATAACGGAAAAGGAAGTAGTGGAGAAAAACTACGATGCTGATGTGGACTTGCTTTTTGTTTTCAATGCTCTTACCGGGGATGAAAACATGCGTATCAGAGTGTTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

85

Amino Acids

9.88

Weight (kDa)

4.69

Isoelectric Point (pI)

18.55

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 77
AfaI GTAC 1 cut(s) 94
AgsI TTSAA 2 cut(s) 83, 214
AluBI AGCT 1 cut(s) 86
AluI AGCT 1 cut(s) 86
ApoI RAATTY 1 cut(s) 77
ArsI GACNNNNNNTTYG 4 cut(s) 7, 39, 188, 220
AsuC2I CCSGG 1 cut(s) 226
BaeI ACNNNNGTAYC 1 cut(s) 226
BbsI GAAGAC 1 cut(s) 137
BccI CCATC 1 cut(s) 94
BciVI GTATCC 1 cut(s) 125
BcnI CCSGG 1 cut(s) 226
BfaI CTAG 1 cut(s) 89
BfuI GTATCC 1 cut(s) 125
Bme1390I CCNGG 1 cut(s) 226
BmrFI CCNGG 1 cut(s) 226
BmsI GCATC 1 cut(s) 175
BpiI GAAGAC 1 cut(s) 137
BpuMI CCSGG 1 cut(s) 226
BsaJI CCNNGG 1 cut(s) 225
BseDI CCNNGG 1 cut(s) 225
BseGI GGATG 2 cut(s) 105, 235
BsgI GTGCAG 1 cut(s) 32
BsiSI CCGG 1 cut(s) 225
BssECI CCNNGG 1 cut(s) 225
BstF5I GGATG 2 cut(s) 105, 235
BstNSI RCATGY 1 cut(s) 241
BstSCI CCNGG 1 cut(s) 224
BstV2I GAAGAC 1 cut(s) 137
BsuI GTATCC 1 cut(s) 125
BtsCI GGATG 2 cut(s) 105, 235
BtsI GCAGTG 1 cut(s) 147
BtsIMutI CAGTG 1 cut(s) 147
Csp6I GTAC 1 cut(s) 93
CviAII CATG 2 cut(s) 96, 238
CviJI RGCY 1 cut(s) 86
CviKI_1 RGCY 1 cut(s) 86
CviQI GTAC 1 cut(s) 93
FaeI CATG 2 cut(s) 99, 241
FaiI YATR 5 cut(s) 19, 21, 97, 152, 239
FatI CATG 2 cut(s) 95, 237
FokI GGATG 2 cut(s) 112, 242
FspBI CTAG 1 cut(s) 89
HapII CCGG 1 cut(s) 225
Hin1II CATG 2 cut(s) 99, 241
HpaII CCGG 1 cut(s) 225
Hpy166II GTNNAC 1 cut(s) 196
Hpy188I TCNGA 1 cut(s) 248
Hpy8I GTNNAC 1 cut(s) 196
HpyAV CCTTC 1 cut(s) 52
HpyCH4V TGCA 1 cut(s) 13
Hsp92II CATG 2 cut(s) 99, 241
LpnPI CCDG 1 cut(s) 238
LweI GCATC 1 cut(s) 175
MaeI CTAG 1 cut(s) 89
MboII GAAGA 2 cut(s) 134, 142
MluCI AATT 2 cut(s) 66, 77
MseI TTAA 1 cut(s) 69
MspI CCGG 1 cut(s) 225
MspR9I CCNGG 1 cut(s) 226
NciI CCSGG 1 cut(s) 226
NlaIII CATG 2 cut(s) 99, 241
NspI RCATGY 1 cut(s) 241
RsaI GTAC 1 cut(s) 94
RsaNI GTAC 1 cut(s) 93
SaqAI TTAA 1 cut(s) 69
ScrFI CCNGG 1 cut(s) 226
SetI ASST 2 cut(s) 88, 94
SfaNI GCATC 1 cut(s) 175
SgeI CNNG 8 cut(s) 53, 101, 108, 131, 211, 237, 238, 250
Sse9I AATT 2 cut(s) 66, 77
SspMI CTAG 1 cut(s) 89
StyD4I CCNGG 1 cut(s) 224
TaqII GACCGA 1 cut(s) 149
TasI AATT 2 cut(s) 66, 77
Tru1I TTAA 1 cut(s) 69
Tru9I TTAA 1 cut(s) 69
TscAI CASTG 1 cut(s) 147
TspDTI ATGAA 1 cut(s) 246
TspGWI ACGGA 1 cut(s) 170
TspRI CASTG 1 cut(s) 147
XapI RAATTY 1 cut(s) 77
XceI RCATGY 1 cut(s) 241
XspI CTAG 1 cut(s) 89
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.