Rmu_sc0004270.1_g000007

Haloacid dehalogenase-like hydrolase domain-containing protein Sgpp

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004270.1
Physical Location & Seq
Forward (+)
20707 .. 21135
429 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004270.1_g000007.1.cds

Sequence Viewer

Length: 321 bp
atgaagggcttacataagttgcgggaatggattgaaaatcaaggcttgaaacgggctgcagtaacaaatgcaccaagaccaaatggcgagctattagtatcagcactggacctcctgagtttctttgaagttctagttattgcaaatgaatgtgatagagcaaaaccatttcctgacccttacttgaaagctctccaagcacttaatgtgtcaaataagcatgcattcgtctttgaggattttgtctcaggagtaaaagctggagtggcagctggaatgccggtggtgggtttgggcacaaggaaccctatgttcaagtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

106

Amino Acids

11.59

Weight (kDa)

9.25

Isoelectric Point (pI)

31.15

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 22
AfiI CCNNNNNNNGG 1 cut(s) 287
AgsI TTSAA 5 cut(s) 35, 49, 128, 187, 316
AluBI AGCT 4 cut(s) 91, 191, 260, 272
AluI AGCT 4 cut(s) 91, 191, 260, 272
Alw26I GTCTC 1 cut(s) 250
ApeKI GCWGC 2 cut(s) 56, 269
AspS9I GGNCC 1 cut(s) 109
AvaII GGWCC 1 cut(s) 109
BaeGI GKGCMC 1 cut(s) 299
BbvI GCAGC 2 cut(s) 43, 281
BcoDI GTCTC 1 cut(s) 250
BfaI CTAG 1 cut(s) 134
BfmI CTRYAG 1 cut(s) 57
BisI GCNGC 2 cut(s) 57, 270
BlsI GCNGC 2 cut(s) 58, 271
Bme18I GGWCC 1 cut(s) 109
BmgT120I GGNCC 1 cut(s) 109
BmiI GGNNCC 1 cut(s) 305
BpmI CTGGAG 1 cut(s) 282
BsaXI ACNNNNNCTCC 2 cut(s) 96, 126
Bsc4I CCNNNNNNNGG 1 cut(s) 287
Bse118I RCCGGY 1 cut(s) 280
Bse1I ACTGG 1 cut(s) 111
BseLI CCNNNNNNNGG 1 cut(s) 287
BseMII CTCAG 2 cut(s) 107, 261
BseNI ACTGG 1 cut(s) 111
BseSI GKGCMC 1 cut(s) 299
BseXI GCAGC 2 cut(s) 43, 281
BsiSI CCGG 1 cut(s) 281
BslI CCNNNNNNNGG 1 cut(s) 287
BsmAI GTCTC 1 cut(s) 250
BsmI GAATGC 2 cut(s) 224, 282
Bsp1286I GDGCHC 1 cut(s) 299
BspACI CCGC 1 cut(s) 22
BspCNI CTCAG 2 cut(s) 108, 260
BspLI GGNNCC 1 cut(s) 305
BspMAI CTGCAG 1 cut(s) 61
BsrFI RCCGGY 1 cut(s) 280
BsrI ACTGG 1 cut(s) 111
BssAI RCCGGY 1 cut(s) 280
BstC8I GCNNGC 2 cut(s) 89, 222
BstDEI CTNAG 2 cut(s) 116, 247
BstMAI GTCTC 1 cut(s) 250
BstMWI GCNNNNNNNGC 2 cut(s) 197, 266
BstNSI RCATGY 1 cut(s) 224
BstSFI CTRYAG 1 cut(s) 57
BstSLI GKGCMC 1 cut(s) 299
BstV1I GCAGC 2 cut(s) 43, 281
BtsIMutI CAGTG 1 cut(s) 104
Cac8I GCNNGC 2 cut(s) 89, 222
Cfr10I RCCGGY 1 cut(s) 280
Cfr13I GGNCC 1 cut(s) 109
CviAII CATG 1 cut(s) 221
CviJI RGCY 7 cut(s) 9, 45, 56, 91, 191, 260, 272
CviKI_1 RGCY 7 cut(s) 9, 45, 56, 91, 191, 260, 272
DdeI CTNAG 2 cut(s) 116, 247
Eco47I GGWCC 1 cut(s) 109
EcoT22I ATGCAT 1 cut(s) 226
FaeI CATG 1 cut(s) 224
FaiI YATR 3 cut(s) 15, 222, 311
FatI CATG 1 cut(s) 220
FauI CCCGC 1 cut(s) 15
Fnu4HI GCNGC 2 cut(s) 57, 270
Fsp4HI GCNGC 2 cut(s) 57, 270
FspBI CTAG 1 cut(s) 134
GluI GCNGC 2 cut(s) 57, 270
GsuI CTGGAG 1 cut(s) 282
HapII CCGG 1 cut(s) 281
Hin1II CATG 1 cut(s) 224
HpaII CCGG 1 cut(s) 281
Hpy188III TCNNGA 3 cut(s) 115, 173, 249
HpyCH4V TGCA 4 cut(s) 59, 71, 143, 224
HpyF10VI GCNNNNNNNGC 2 cut(s) 197, 266
HpyF3I CTNAG 2 cut(s) 116, 247
Hsp92II CATG 1 cut(s) 224
LpnPI CCDG 7 cut(s) 92, 128, 186, 234, 246, 258, 294
Lsp1109I GCAGC 2 cut(s) 43, 281
MaeI CTAG 1 cut(s) 134
MaeIII GTNAC 1 cut(s) 61
MhlI GDGCHC 1 cut(s) 299
MnlI CCTC 2 cut(s) 122, 229
Mph1103I ATGCAT 1 cut(s) 226
MseI TTAA 1 cut(s) 204
MspA1I CMGCKG 1 cut(s) 272
MspI CCGG 1 cut(s) 281
Mva1269I GAATGC 2 cut(s) 224, 282
MwoI GCNNNNNNNGC 2 cut(s) 197, 266
NlaIII CATG 1 cut(s) 224
NlaIV GGNNCC 1 cut(s) 305
NsiI ATGCAT 1 cut(s) 226
NspI RCATGY 1 cut(s) 224
PaeI GCATGC 1 cut(s) 224
PctI GAATGC 2 cut(s) 224, 282
PkrI GCNGC 2 cut(s) 58, 271
PspN4I GGNNCC 1 cut(s) 305
PspPI GGNCC 1 cut(s) 109
PstI CTGCAG 1 cut(s) 61
PvuII CAGCTG 1 cut(s) 272
SaqAI TTAA 1 cut(s) 204
SatI GCNGC 2 cut(s) 57, 270
Sau96I GGNCC 1 cut(s) 109
SduI GDGCHC 1 cut(s) 299
SetI ASST 5 cut(s) 93, 114, 193, 262, 274
SfcI CTRYAG 1 cut(s) 57
SinI GGWCC 1 cut(s) 109
SphI GCATGC 1 cut(s) 224
SsiI CCGC 1 cut(s) 22
SspMI CTAG 1 cut(s) 134
Tru1I TTAA 1 cut(s) 204
Tru9I TTAA 1 cut(s) 204
TscAI CASTG 1 cut(s) 111
TseI GCWGC 2 cut(s) 56, 269
TspDTI ATGAA 2 cut(s) 17, 162
TspRI CASTG 1 cut(s) 111
VpaK11BI GGWCC 1 cut(s) 109
XceI RCATGY 1 cut(s) 224
XspI CTAG 1 cut(s) 134
Zsp2I ATGCAT 1 cut(s) 226
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.