Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0004282.1

Orthogroup ID

OG0002580

Physical Location & Seq

Genomic Coordinates Forward (+)

41814 .. 42176

Gene Structure 363 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0004282.1_g000007.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 363 bp

atgccaaatggtggacctatgatgaactttgctcgttttggtgtttgtgctgatgctggtcctagtgttggccatcaattttatccaaacaatcaagccatgcagacttttctaactgcacagcaatttcaacaactccagatacattctcagaagcaacaacatcagtttcagcagcatcaactacatcaacttcaacaacaacacatgcaggaacaacaacaacaacaacaaccacaaccacctctacaacagcagaaacaacaacaaatcaaggactcgaaaatagaagcaaccatgcagtctccaagccaaaaagataatgctttggaggtcaaccaagcagtagcaaaagattgttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003700 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0005737 GO:0005829 GO:0006355 GO:0008150 GO:0009889 GO:0010468 GO:0010556 GO:0019219 GO:0019222 GO:0031323 GO:0031326 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044444 GO:0044464 GO:0050789 GO:0050794 GO:0051171 GO:0051252 GO:0060255 GO:0065007 GO:0080090 GO:0140110 GO:1903506 GO:2000112 GO:2001141

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

bZIP_1

Protein Analysis

120

Amino Acids

13.81

Weight (kDa)

7.01

Isoelectric Point (pI)

73.98

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002580)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G06070 AT2G31370 AT2G31370 AT2G31370 AT2G31370 AT2G31370 AT2G31370 AT2G31370
fragaria_vesca	FvH4_4g11161 FvH4_4g11161 FvH4_4g11161
malus_domestica	MD04G1043600.v1.1 MD13G1271600.v1.1
prunus_persica	Prupe.1G197700_v2.0.a1 Prupe.1G197700_v2.0.a1
pyrus_communis	pycom13g27740
rosa_chinensis	RchiOBHm_Chr2g0157441 RchiOBHm_Chr4g0407301
rosa_laevigata	RLG00000008734 RLG00000020988
rosa_multiflora	Rmu_sc0001860.1_g000003 Rmu_sc0001860.1_g000004 Rmu_sc0004282.1_g000006 Rmu_sc0004282.1_g000007
rosa_roxburghii	Rroxscaffold_1G00031280 Rroxscaffold_2G00092210 Rroxscaffold_5G00351860 Rroxscaffold_7G00196960
rosa_rugosa	Rorug02G0461300 Rorug04G0078600
rosa_samantha	Rh2AG525600 Rh2BG539900 Rh2CG510200 Rh2DG548700 Rh4AG143300 Rh4BG140900 Rh4CG149700 Rh4DG137200
rosa_wichuraiana	Rw2G043510 Rw4G011650

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	11
AcoI	YGGCCR	1 cut(s)	70
AfiI	CCNNNNNNNGG	2 cut(s)	11, 68
AgsI	TTSAA	2 cut(s)	131, 197
Alw26I	GTCTC	1 cut(s)	309
AoxI	GGCC	1 cut(s)	70
ApeKI	GCWGC	1 cut(s)	175
AspS9I	GGNCC	2 cut(s)	14, 59
AvaII	GGWCC	2 cut(s)	14, 59
BalI	TGGCCA	1 cut(s)	72
BbvI	GCAGC	1 cut(s)	187
BccI	CCATC	1 cut(s)	81
BcoDI	GTCTC	1 cut(s)	309
BfaI	CTAG	1 cut(s)	63
BisI	GCNGC	1 cut(s)	176
BlsI	GCNGC	1 cut(s)	177
Bme18I	GGWCC	2 cut(s)	14, 59
BmgT120I	GGNCC	2 cut(s)	14, 59
BmsI	GCATC	2 cut(s)	43, 187
BpmI	CTGGAG	1 cut(s)	122
Bsc4I	CCNNNNNNNGG	2 cut(s)	11, 68
BseLI	CCNNNNNNNGG	2 cut(s)	11, 68
BseMII	CTCAG	1 cut(s)	164
BseXI	GCAGC	1 cut(s)	187
BsgI	GTGCAG	1 cut(s)	102
BshFI	GGCC	1 cut(s)	72
BslI	CCNNNNNNNGG	2 cut(s)	11, 68
BsmAI	GTCTC	1 cut(s)	309
BsnI	GGCC	1 cut(s)	72
BspANI	GGCC	1 cut(s)	72
BspCNI	CTCAG	1 cut(s)	163
BstDEI	CTNAG	1 cut(s)	150
BstMAI	GTCTC	1 cut(s)	309
BstNSI	RCATGY	1 cut(s)	211
BstV1I	GCAGC	1 cut(s)	187
BsuRI	GGCC	1 cut(s)	72
Cfr13I	GGNCC	2 cut(s)	14, 59
CviAII	CATG	3 cut(s)	100, 208, 298
CviJI	RGCY	3 cut(s)	72, 98, 312
CviKI_1	RGCY	3 cut(s)	72, 98, 312
DdeI	CTNAG	1 cut(s)	150
EaeI	YGGCCR	1 cut(s)	70
Eco47I	GGWCC	2 cut(s)	14, 59
FaeI	CATG	3 cut(s)	103, 211, 301
FaiI	YATR	4 cut(s)	20, 101, 209, 299
FatI	CATG	3 cut(s)	99, 207, 297
Fnu4HI	GCNGC	1 cut(s)	176
Fsp4HI	GCNGC	1 cut(s)	176
FspBI	CTAG	1 cut(s)	63
GluI	GCNGC	1 cut(s)	176
GsuI	CTGGAG	1 cut(s)	122
HaeIII	GGCC	1 cut(s)	72
Hin1II	CATG	3 cut(s)	103, 211, 301
HincII	GTYRAC	1 cut(s)	337
HindII	GTYRAC	1 cut(s)	337
HinfI	GANTC	1 cut(s)	278
Hpy166II	GTNNAC	2 cut(s)	14, 337
Hpy188I	TCNGA	1 cut(s)	153
Hpy188III	TCNNGA	1 cut(s)	139
Hpy8I	GTNNAC	2 cut(s)	14, 337
HpyCH4V	TGCA	4 cut(s)	103, 119, 211, 301
HpyF3I	CTNAG	1 cut(s)	150
Hsp92II	CATG	3 cut(s)	103, 211, 301
LpnPI	CCDG	3 cut(s)	42, 152, 197
Lsp1109I	GCAGC	1 cut(s)	187
LweI	GCATC	2 cut(s)	43, 187
MaeI	CTAG	1 cut(s)	63
MlsI	TGGCCA	1 cut(s)	72
MluCI	AATT	2 cut(s)	77, 125
MluNI	TGGCCA	1 cut(s)	72
MlyI	GAGTC	1 cut(s)	272
MnlI	CCTC	2 cut(s)	255, 325
Mox20I	TGGCCA	1 cut(s)	72
MscI	TGGCCA	1 cut(s)	72
Msp20I	TGGCCA	1 cut(s)	72
NlaIII	CATG	3 cut(s)	103, 211, 301
NspI	RCATGY	1 cut(s)	211
PflMI	CCANNNNNTGG	1 cut(s)	11
PkrI	GCNGC	1 cut(s)	177
PleI	GAGTC	1 cut(s)	272
PpsI	GAGTC	1 cut(s)	272
PspPI	GGNCC	2 cut(s)	14, 59
SatI	GCNGC	1 cut(s)	176
Sau96I	GGNCC	2 cut(s)	14, 59
SchI	GAGTC	1 cut(s)	272
SetI	ASST	3 cut(s)	19, 247, 336
SfaNI	GCATC	2 cut(s)	43, 187
SinI	GGWCC	2 cut(s)	14, 59
Sse9I	AATT	2 cut(s)	77, 125
SspMI	CTAG	1 cut(s)	63
TaqI	TCGA	1 cut(s)	281
TasI	AATT	2 cut(s)	77, 125
TseI	GCWGC	1 cut(s)	175
TspDTI	ATGAA	1 cut(s)	38
Van91I	CCANNNNNTGG	1 cut(s)	11
VpaK11BI	GGWCC	2 cut(s)	14, 59
XceI	RCATGY	1 cut(s)	211
XspI	CTAG	1 cut(s)	63

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.