Rroxscaffold_5G00351860
BZIP Family

transcription factor

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000005
Physical Location & Seq
Reverse (-)
28588862 .. 28599490
10629 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_5G00351860.1

Sequence Viewer

Length: 363 bp
ATGCCAAATGGTGGACCTATGATGAACTTTGCTTGTTTTGGTGCTTGTGCTGATGCTGGTCCTAGTGCTGGTCTTCAATTTTATCCAAACAATCAAGCCATGCACACTCTTCTAACTGCAACGCAGTTTCAACAACTCCGGATACATTCTCGGATGCAGCAACATCAGTTTCAGCAGCATCAACTACATCAACTTCAACAACAACACATGCAGGAACAACAACAACAGCAACAACCACAGCCACCTCTACAACAGCAGCAACAACAACAAAGTGAGGACTTGAAAATAGAAGCAACTATGCAGTCTCCAAGCCAAAAAGATAATGCTTCAGAGGTCAACCAAGCAGTAGTAAAGGACTATTGA

Protein Analysis

120

Amino Acids

13.74

Weight (kDa)

6.0

Isoelectric Point (pI)

89.7

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 11
AccIII TCCGGA 1 cut(s) 138
AcuI CTGAAG 1 cut(s) 312
AfiI CCNNNNNNNGG 2 cut(s) 11, 68
AgsI TTSAA 4 cut(s) 77, 131, 197, 283
Alw26I GTCTC 1 cut(s) 309
Aor13HI TCCGGA 1 cut(s) 138
ApeKI GCWGC 3 cut(s) 157, 175, 256
AspS9I GGNCC 2 cut(s) 14, 59
AvaII GGWCC 2 cut(s) 14, 59
BbsI GAAGAC 1 cut(s) 65
BbvI GCAGC 3 cut(s) 169, 187, 268
BciVI GTATCC 1 cut(s) 135
BcoDI GTCTC 1 cut(s) 309
BfaI CTAG 1 cut(s) 63
BfuI GTATCC 1 cut(s) 135
BisI GCNGC 3 cut(s) 158, 176, 257
BlsI GCNGC 3 cut(s) 159, 177, 258
Bme18I GGWCC 2 cut(s) 14, 59
BmgT120I GGNCC 2 cut(s) 14, 59
BmsI GCATC 3 cut(s) 43, 144, 187
BpiI GAAGAC 1 cut(s) 65
BsaWI WCCGGW 1 cut(s) 138
Bsc4I CCNNNNNNNGG 2 cut(s) 11, 68
BseAI TCCGGA 1 cut(s) 138
BseGI GGATG 1 cut(s) 159
BseLI CCNNNNNNNGG 2 cut(s) 11, 68
BseXI GCAGC 3 cut(s) 169, 187, 268
BsiSI CCGG 1 cut(s) 139
BslI CCNNNNNNNGG 2 cut(s) 11, 68
BsmAI GTCTC 1 cut(s) 309
Bsp13I TCCGGA 1 cut(s) 138
BspEI TCCGGA 1 cut(s) 138
Bst6I CTCTTC 1 cut(s) 114
BstF5I GGATG 1 cut(s) 159
BstMAI GTCTC 1 cut(s) 309
BstNSI RCATGY 1 cut(s) 211
BstV1I GCAGC 3 cut(s) 169, 187, 268
BstV2I GAAGAC 1 cut(s) 65
BsuI GTATCC 1 cut(s) 135
BtsCI GGATG 1 cut(s) 159
Cfr13I GGNCC 2 cut(s) 14, 59
CviAII CATG 2 cut(s) 100, 208
CviJI RGCY 3 cut(s) 98, 241, 312
CviKI_1 RGCY 3 cut(s) 98, 241, 312
Eam1104I CTCTTC 1 cut(s) 114
EarI CTCTTC 1 cut(s) 114
Eco47I GGWCC 2 cut(s) 14, 59
Eco57I CTGAAG 1 cut(s) 312
FaeI CATG 2 cut(s) 103, 211
FaiI YATR 4 cut(s) 20, 101, 209, 299
FatI CATG 2 cut(s) 99, 207
Fnu4HI GCNGC 3 cut(s) 158, 176, 257
FokI GGATG 1 cut(s) 166
Fsp4HI GCNGC 3 cut(s) 158, 176, 257
FspBI CTAG 1 cut(s) 63
GluI GCNGC 3 cut(s) 158, 176, 257
HapII CCGG 1 cut(s) 139
Hin1II CATG 2 cut(s) 103, 211
HincII GTYRAC 1 cut(s) 337
HindII GTYRAC 1 cut(s) 337
HpaII CCGG 1 cut(s) 139
Hpy166II GTNNAC 2 cut(s) 14, 337
Hpy188I TCNGA 2 cut(s) 153, 331
Hpy188III TCNNGA 1 cut(s) 139
Hpy8I GTNNAC 2 cut(s) 14, 337
HpyCH4V TGCA 5 cut(s) 103, 119, 157, 211, 301
Hsp92II CATG 2 cut(s) 103, 211
Kpn2I TCCGGA 1 cut(s) 138
LpnPI CCDG 4 cut(s) 42, 54, 152, 197
Lsp1109I GCAGC 3 cut(s) 169, 187, 268
LweI GCATC 3 cut(s) 43, 144, 187
MaeI CTAG 1 cut(s) 63
MboII GAAGA 2 cut(s) 65, 101
MluCI AATT 1 cut(s) 77
MnlI CCTC 3 cut(s) 255, 268, 325
MroI TCCGGA 1 cut(s) 138
MspI CCGG 1 cut(s) 139
NlaIII CATG 2 cut(s) 103, 211
NspI RCATGY 1 cut(s) 211
PflMI CCANNNNNTGG 1 cut(s) 11
PkrI GCNGC 3 cut(s) 159, 177, 258
PspPI GGNCC 2 cut(s) 14, 59
SatI GCNGC 3 cut(s) 158, 176, 257
Sau96I GGNCC 2 cut(s) 14, 59
SetI ASST 3 cut(s) 19, 247, 336
SfaNI GCATC 3 cut(s) 43, 144, 187
SinI GGWCC 2 cut(s) 14, 59
Sse9I AATT 1 cut(s) 77
SspMI CTAG 1 cut(s) 63
TasI AATT 1 cut(s) 77
TseI GCWGC 3 cut(s) 157, 175, 256
TspDTI ATGAA 1 cut(s) 38
Van91I CCANNNNNTGG 1 cut(s) 11
VpaK11BI GGWCC 2 cut(s) 14, 59
XceI RCATGY 1 cut(s) 211
XspI CTAG 1 cut(s) 63
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.