Rmu_sc0004866.1_g000026

Abnormal spindle-like microcephaly-associated protein homolog

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004866.1
Physical Location & Seq
Forward (+)
153465 .. 154037
573 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004866.1_g000026.1.cds

Sequence Viewer

Length: 573 bp
atgaagagtgctgagaaggtttttgctattatacttaaagttagtgttgtttcttggaatgtcatggtaactgggtatgacctgatatttcagaatcagaaagttattgaatatctacgaagaatggaattttggggctttgaacattatgaggtcacatatagcaatttacttgcagcatatgtcaagtctggtattgttctacatgatgatggaatgatgattgtcggagatgatattgctgatggggataaggagcttactatttccttgctttggaatttgtttgttcatttgcggctacctcctttggtcaagaaaaaaacattagctgctgaaatatgcaaaattcagggaaatatggatagcttcattaatgttgaatttatgagtttggagttgctggaaaatgagtatcacattgatcaagtagatgtcagggctgttattgcatttgtaattattcaattgcattcaaatgaagctgctgggatatacaaagagttgaatatgatggtagggagtgcatataagtgtgatatctcgcactcgattttgatttattgtctttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

190

Amino Acids

21.73

Weight (kDa)

5.18

Isoelectric Point (pI)

25.22

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 298
AcsI RAATTY 4 cut(s) 128, 280, 348, 383
AfiI CCNNNNNNNGG 1 cut(s) 276
AgsI TTSAA 6 cut(s) 110, 143, 383, 467, 477, 508
AjuI GAANNNNNNNTTGG 2 cut(s) 115, 147
AluBI AGCT 4 cut(s) 259, 332, 369, 485
AluI AGCT 4 cut(s) 259, 332, 369, 485
ApeKI GCWGC 3 cut(s) 176, 332, 485
ApoI RAATTY 4 cut(s) 128, 280, 348, 383
AseI ATTAAT 1 cut(s) 375
BbvI GCAGC 3 cut(s) 188, 319, 472
BccI CCATC 3 cut(s) 206, 239, 508
BclI TGATCA 1 cut(s) 424
BisI GCNGC 4 cut(s) 177, 299, 333, 486
BlsI GCNGC 4 cut(s) 178, 300, 334, 487
BmrI ACTGGG 1 cut(s) 81
BmuI ACTGGG 1 cut(s) 81
Bsc4I CCNNNNNNNGG 1 cut(s) 276
Bse1I ACTGG 1 cut(s) 76
BseLI CCNNNNNNNGG 1 cut(s) 276
BseNI ACTGG 1 cut(s) 76
BseXI GCAGC 3 cut(s) 188, 319, 472
BseYI CCCAGC 1 cut(s) 488
BslI CCNNNNNNNGG 1 cut(s) 276
BsmI GAATGC 1 cut(s) 472
Bsp143I GATC 1 cut(s) 424
BspACI CCGC 1 cut(s) 298
BspCNI CTCAG 1 cut(s) 4
BsrI ACTGG 1 cut(s) 76
BssMI GATC 1 cut(s) 424
BstDEI CTNAG 1 cut(s) 12
BstKTI GATC 1 cut(s) 427
BstMBI GATC 1 cut(s) 424
BstMWI GCNNNNNNNGC 1 cut(s) 449
BstV1I GCAGC 3 cut(s) 188, 319, 472
CviAII CATG 2 cut(s) 64, 206
CviJI RGCY 7 cut(s) 138, 259, 301, 332, 369, 443, 485
CviKI_1 RGCY 7 cut(s) 138, 259, 301, 332, 369, 443, 485
DdeI CTNAG 1 cut(s) 12
DpnI GATC 1 cut(s) 426
DpnII GATC 1 cut(s) 424
Eco32I GATATC 1 cut(s) 541
EcoRV GATATC 1 cut(s) 541
FaeI CATG 2 cut(s) 67, 209
FatI CATG 2 cut(s) 63, 205
FauNDI CATATG 1 cut(s) 181
FbaI TGATCA 1 cut(s) 424
Fnu4HI GCNGC 4 cut(s) 177, 299, 333, 486
Fsp4HI GCNGC 4 cut(s) 177, 299, 333, 486
GluI GCNGC 4 cut(s) 177, 299, 333, 486
GsaI CCCAGC 1 cut(s) 492
Hin1II CATG 2 cut(s) 67, 209
HinfI GANTC 1 cut(s) 94
Hpy188I TCNGA 3 cut(s) 93, 99, 230
Hpy188III TCNNGA 1 cut(s) 316
HpyAV CCTTC 1 cut(s) 10
HpyCH4V TGCA 5 cut(s) 176, 345, 452, 472, 527
HpyF10VI GCNNNNNNNGC 1 cut(s) 449
HpyF3I CTNAG 1 cut(s) 12
Hsp92II CATG 2 cut(s) 67, 209
Ksp22I TGATCA 1 cut(s) 424
Kzo9I GATC 1 cut(s) 424
LmnI GCTCC 1 cut(s) 256
LpnPI CCDG 7 cut(s) 57, 95, 177, 338, 389, 424, 474
Lsp1109I GCAGC 3 cut(s) 188, 319, 472
MaeIII GTNAC 2 cut(s) 67, 154
MalI GATC 1 cut(s) 426
MboI GATC 1 cut(s) 424
MboII GAAGA 2 cut(s) 16, 132
MfeI CAATTG 1 cut(s) 467
MluCI AATT 7 cut(s) 128, 166, 280, 348, 383, 459, 467
MmeI TCCRAC 1 cut(s) 208
MnlI CCTC 2 cut(s) 145, 315
MseI TTAA 2 cut(s) 36, 375
MslI CAYNNNNRTG 3 cut(s) 210, 477, 532
MunI CAATTG 1 cut(s) 467
Mva1269I GAATGC 1 cut(s) 472
MwoI GCNNNNNNNGC 1 cut(s) 449
NdeI CATATG 1 cut(s) 181
NdeII GATC 1 cut(s) 424
NlaIII CATG 2 cut(s) 67, 209
NmuCI GTSAC 1 cut(s) 154
PctI GAATGC 1 cut(s) 472
PfeI GAWTC 1 cut(s) 94
PkrI GCNGC 4 cut(s) 178, 300, 334, 487
PshBI ATTAAT 1 cut(s) 375
PspFI CCCAGC 1 cut(s) 488
RseI CAYNNNNRTG 3 cut(s) 210, 477, 532
SaqAI TTAA 2 cut(s) 36, 375
SatI GCNGC 4 cut(s) 177, 299, 333, 486
Sau3AI GATC 1 cut(s) 424
SetI ASST 8 cut(s) 21, 84, 156, 261, 307, 334, 371, 487
SmiMI CAYNNNNRTG 3 cut(s) 210, 477, 532
Sse9I AATT 7 cut(s) 128, 166, 280, 348, 383, 459, 467
SsiI CCGC 1 cut(s) 298
TaqI TCGA 1 cut(s) 551
TasI AATT 7 cut(s) 128, 166, 280, 348, 383, 459, 467
TauI GCSGC 1 cut(s) 301
TfiI GAWTC 1 cut(s) 94
Tru1I TTAA 2 cut(s) 36, 375
Tru9I TTAA 2 cut(s) 36, 375
TseFI GTSAC 1 cut(s) 154
TseI GCWGC 3 cut(s) 176, 332, 485
Tsp45I GTSAC 1 cut(s) 154
TspDTI ATGAA 4 cut(s) 17, 281, 361, 495
VspI ATTAAT 1 cut(s) 375
XapI RAATTY 4 cut(s) 128, 280, 348, 383
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.