Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0042233.1

Orthogroup ID

OG0005182

Physical Location & Seq

Genomic Coordinates Reverse (-)

594 .. 1835

Gene Structure 1242 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0042233.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1242 bp

atggagcatgaattgattgagctccgaaatcacatttcatctcaaggagttgtgaacttgcttgaagaggtatttgaacttgcctttgcaaaatttggtcccagtgttattttattgactggttttcaaggagttggaaggacaacagtgttcaatacattgaagatggcatttctgttgtgtcaggttgcactaacatgcatgggaaagttacaagataaacgacctttattctctggtgtctttagttatgataattatgcatgttttgatattgtcatggaaaaacaattaccaaacccagcttgtcattcaatcttgtttaggctcatattggcaattcttgctatggtacattggctcgctaattacgatgaaggacctaattggcaaggagcaaagagaaccagtacatggtttatcaaaatgcatggcttccatcatattagcactaacaaagtgctccagcaacacacttgtctgcaatgtttgcacctagttctgaggaaactcattcaggcagaaactcaagtaagtacttctattctgcgtcaatcacatagcaatagttctcatcttgtgtggccattcattgttgtagagagtgagtttttagctaaaatcccaaaagcacaagcactatgtgcctacaatatgaagtatctcagggaattgactcaagtctttaacattaagggtcaaatagaatttgtggactatggagtgaattttctctcatctgatattgtgcttggagaacatttatttgttgttcttcaagatgggttgcgccttcttagagccattcaacttttgaaggatgactgctatatcctaatgaaaatggttgttccatcagatacaaacaaaaagcacctgccaagttgtggcagttctctgcattatcttgaggctgttattgttttacatgatgatggaaatatgattgtggaagatgattttgctgatggagacaaggaactttctatttccttggttcagaatctgtttgttcatttacaggtacatctattggtcaagaaaacaatattagctaatgaaatatgcaaaattcagggaattatggattgctccattaatgctgattctcctccaatattttcatgctttggtgagctagctttgaccatgattttgtactccttatggttgattagagcctggcacaaaagcatgggttacttgccatttgaagactctgattatccaacaatgccctag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Arm CH IQ

Protein Analysis

413

Amino Acids

46.91

Weight (kDa)

6.21

Isoelectric Point (pI)

51.1

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005182)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_3g14300 FvH4_3g19610 FvH4_4g30860 FvH4_5g18841
rosa_chinensis	RchiOBHm_Chr1g0357401 RchiOBHm_Chr2g0112171 RchiOBHm_Chr2g0125391 RchiOBHm_Chr5g0054711 RchiOBHm_Chr5g0064471 RchiOBHm_Chr6g0271351 RchiOBHm_Chr7g0191401 RchiOBHm_Chr7g0214711
rosa_laevigata	RLG00000017451 RLG00000022476
rosa_multiflora	Rmu_sc0000331.1_g000014 Rmu_sc0000795.1_g000108 Rmu_sc0004866.1_g000026 Rmu_sc0005111.1_g000002 Rmu_sc0006642.1_g000002 Rmu_sc0006695.1_g000080 Rmu_sc0009740.1_g000002 Rmu_sc0021244.1_g000001 Rmu_sc0042233.1_g000001
rosa_roxburghii	Rroxscaffold_1G00019300 Rroxscaffold_2G00085360
rosa_rugosa	Rorug04G0054100 Rorug05G0017000 Rorug06G0337100 Rorug07G0115500
rosa_samantha	Rh6AG133600

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AarI	CACCTGC	1 cut(s)	885
Acc36I	ACCTGC	1 cut(s)	885
AccB7I	CCANNNNNTGG	2 cut(s)	414, 887
AcoI	YGGCCR	1 cut(s)	584
AcsI	RAATTY	4 cut(s)	92, 707, 727, 1071
AdeI	CACNNNGTG	1 cut(s)	644
AfaI	GTAC	5 cut(s)	354, 412, 538, 1026, 1160
AfiI	CCNNNNNNNGG	2 cut(s)	414, 887
AjnI	CCWGG	1 cut(s)	1181
AluBI	AGCT	6 cut(s)	22, 305, 617, 1055, 1138, 1142
AluI	AGCT	6 cut(s)	22, 305, 617, 1055, 1138, 1142
Alw21I	GWGCWC	2 cut(s)	24, 465
Alw26I	GTCTC	1 cut(s)	966
AlwNI	CAGNNNCTG	1 cut(s)	1006
AoxI	GGCC	1 cut(s)	584
ApoI	RAATTY	4 cut(s)	92, 707, 727, 1071
ArsI	GACNNNNNNTTYG	2 cut(s)	1138, 1170
AseI	ATTAAT	1 cut(s)	1098
AspLEI	GCGC	1 cut(s)	792
AspS9I	GGNCC	2 cut(s)	98, 380
AsuHPI	GGTGA	1 cut(s)	1145
AsuNHI	GCTAGC	1 cut(s)	1138
AvaII	GGWCC	2 cut(s)	98, 380
BalI	TGGCCA	1 cut(s)	586
BanII	GRGCYC	1 cut(s)	24
BbsI	GAAGAC	1 cut(s)	1221
Bbv12I	GWGCWC	2 cut(s)	24, 465
BccI	CCATC	6 cut(s)	160, 447, 776, 862, 929, 962
BciT130I	CCWGG	1 cut(s)	1183
BcoDI	GTCTC	1 cut(s)	966
BfaI	CTAG	3 cut(s)	497, 1139, 1240
BfuAI	ACCTGC	1 cut(s)	885
BmcAI	AGTACT	1 cut(s)	538
Bme1390I	CCNGG	1 cut(s)	1183
Bme18I	GGWCC	2 cut(s)	98, 380
BmgT120I	GGNCC	2 cut(s)	98, 380
BmiI	GGNNCC	1 cut(s)	100
BmrFI	CCNGG	1 cut(s)	1183
BmrI	ACTGGG	1 cut(s)	96
BmtI	GCTAGC	1 cut(s)	1142
BmuI	ACTGGG	1 cut(s)	96
BoxI	GACNNNNGTC	1 cut(s)	680
BpiI	GAAGAC	1 cut(s)	1221
BpmI	CTGGAG	1 cut(s)	449
BpuEI	CTTGAG	4 cut(s)	27, 513, 663, 929
BsaJI	CCNNGG	1 cut(s)	993
Bsc4I	CCNNNNNNNGG	2 cut(s)	414, 887
Bse1I	ACTGG	3 cut(s)	102, 124, 408
Bse3DI	GCAATG	1 cut(s)	491
BseBI	CCWGG	1 cut(s)	1183
BseDI	CCNNGG	1 cut(s)	993
BseGI	GGATG	1 cut(s)	826
BseLI	CCNNNNNNNGG	2 cut(s)	414, 887
BseMI	GCAATG	1 cut(s)	491
BseMII	CTCAG	2 cut(s)	494, 679
BseNI	ACTGG	3 cut(s)	102, 124, 408
BseRI	GAGGAG	1 cut(s)	1101
BseYI	CCCAGC	1 cut(s)	301
BshFI	GGCC	1 cut(s)	586
BsiHKAI	GWGCWC	2 cut(s)	24, 465
BslFI	GGGAC	1 cut(s)	84
BslI	CCNNNNNNNGG	2 cut(s)	414, 887
BsmAI	GTCTC	1 cut(s)	966
BsmFI	GGGAC	1 cut(s)	84
BsnI	GGCC	1 cut(s)	586
Bsp1286I	GDGCHC	2 cut(s)	24, 465
BspANI	GGCC	1 cut(s)	586
BspCNI	CTCAG	2 cut(s)	495, 678
BspLI	GGNNCC	1 cut(s)	100
BspMI	ACCTGC	1 cut(s)	885
BspOI	GCTAGC	1 cut(s)	1142
BsrDI	GCAATG	1 cut(s)	491
BsrI	ACTGG	3 cut(s)	102, 124, 408
BssECI	CCNNGG	1 cut(s)	993
BssT1I	CCWWGG	1 cut(s)	993
Bst2UI	CCWGG	1 cut(s)	1183
Bst4CI	ACNGT	1 cut(s)	148
Bst6I	CTCTTC	1 cut(s)	60
BstAPI	GCANNNNNTGC	3 cut(s)	344, 490, 644
BstC8I	GCNNGC	2 cut(s)	363, 1140
BstDEI	CTNAG	3 cut(s)	503, 665, 797
BstF5I	GGATG	1 cut(s)	826
BstHHI	GCGC	1 cut(s)	792
BstMAI	GTCTC	1 cut(s)	966
BstMWI	GCNNNNNNNGC	3 cut(s)	344, 490, 644
BstNI	CCWGG	1 cut(s)	1183
BstNSI	RCATGY	2 cut(s)	201, 267
BstPAI	GACNNNNGTC	1 cut(s)	680
BstSCI	CCNGG	1 cut(s)	1181
BstV2I	GAAGAC	1 cut(s)	1221
BsuRI	GGCC	1 cut(s)	586
BtsCI	GGATG	1 cut(s)	826
BtsIMutI	CAGTG	2 cut(s)	109, 153
BveI	ACCTGC	1 cut(s)	885
Cac8I	GCNNGC	2 cut(s)	363, 1140
CaiI	CAGNNNCTG	1 cut(s)	1006
CfoI	GCGC	1 cut(s)	792
Cfr13I	GGNCC	2 cut(s)	98, 380
CseI	GACGC	1 cut(s)	539
Csp6I	GTAC	5 cut(s)	353, 411, 537, 1025, 1159
CviQI	GTAC	5 cut(s)	353, 411, 537, 1025, 1159
DdeI	CTNAG	3 cut(s)	503, 665, 797
DraIII	CACNNNGTG	1 cut(s)	644
EaeI	YGGCCR	1 cut(s)	584
Eam1104I	CTCTTC	1 cut(s)	60
EarI	CTCTTC	1 cut(s)	60
Ecl136II	GAGCTC	1 cut(s)	22
Eco130I	CCWWGG	1 cut(s)	993
Eco24I	GRGCYC	1 cut(s)	24
Eco47I	GGWCC	2 cut(s)	98, 380
Eco53kI	GAGCTC	1 cut(s)	22
EcoICRI	GAGCTC	1 cut(s)	22
EcoO109I	RGGNCCY	1 cut(s)	380
EcoRII	CCWGG	1 cut(s)	1181
EcoT14I	CCWWGG	1 cut(s)	993
EcoT22I	ATGCAT	3 cut(s)	203, 265, 432
EcoT38I	GRGCYC	1 cut(s)	24
ErhI	CCWWGG	1 cut(s)	993
FaqI	GGGAC	1 cut(s)	84
FokI	GGATG	1 cut(s)	833
FriOI	GRGCYC	1 cut(s)	24
FspBI	CTAG	3 cut(s)	497, 1139, 1240
GlaI	GCGC	1 cut(s)	791
GsaI	CCCAGC	1 cut(s)	305
GsuI	CTGGAG	1 cut(s)	449
HaeIII	GGCC	1 cut(s)	586
HgaI	GACGC	1 cut(s)	539
HhaI	GCGC	1 cut(s)	792
Hin6I	GCGC	1 cut(s)	790
HinP1I	GCGC	1 cut(s)	790
HinfI	GANTC	4 cut(s)	676, 1003, 1106, 1217
HphI	GGTGA	1 cut(s)	1145
Hpy166II	GTNNAC	2 cut(s)	55, 715
Hpy188I	TCNGA	6 cut(s)	26, 504, 742, 859, 1002, 1222
Hpy188III	TCNNGA	3 cut(s)	779, 908, 1039
Hpy8I	GTNNAC	2 cut(s)	55, 715
HpyAV	CCTTC	4 cut(s)	132, 371, 803, 811
HpyCH4III	ACNGT	1 cut(s)	148
HpyCH4V	TGCA	9 cut(s)	89, 191, 201, 263, 430, 484, 493, 901, 1068
HpyF10VI	GCNNNNNNNGC	3 cut(s)	344, 490, 644
HpyF3I	CTNAG	3 cut(s)	503, 665, 797
HspAI	GCGC	1 cut(s)	790
LmnI	GCTCC	5 cut(s)	4, 27, 395, 468, 1097
MaeI	CTAG	3 cut(s)	497, 1139, 1240
MaeIII	GTNAC	2 cut(s)	210, 1199
MboII	GAAGA	5 cut(s)	77, 175, 767, 965, 1226
MhlI	GDGCHC	2 cut(s)	24, 465
MlsI	TGGCCA	1 cut(s)	586
MluNI	TGGCCA	1 cut(s)	586
MlyI	GAGTC	2 cut(s)	670, 1211
MmeI	TCCRAC	1 cut(s)	115
MnlI	CCTC	4 cut(s)	61, 498, 904, 1122
Mox20I	TGGCCA	1 cut(s)	586
Mph1103I	ATGCAT	3 cut(s)	203, 265, 432
MscI	TGGCCA	1 cut(s)	586
MseI	TTAA	3 cut(s)	687, 693, 1098
MslI	CAYNNNNRTG	2 cut(s)	196, 933
Msp20I	TGGCCA	1 cut(s)	586
MspR9I	CCNGG	1 cut(s)	1183
MvaI	CCWGG	1 cut(s)	1183
MwoI	GCNNNNNNNGC	3 cut(s)	344, 490, 644
NheI	GCTAGC	1 cut(s)	1138
NlaIV	GGNNCC	1 cut(s)	100
NsiI	ATGCAT	3 cut(s)	203, 265, 432
NspI	RCATGY	2 cut(s)	201, 267
PaqCI	CACCTGC	1 cut(s)	885
PcsI	WCGNNNNNNNCGW	1 cut(s)	369
PfeI	GAWTC	2 cut(s)	1003, 1106
PflMI	CCANNNNNTGG	2 cut(s)	414, 887
PleI	GAGTC	2 cut(s)	670, 1211
PpsI	GAGTC	2 cut(s)	670, 1211
PpuMI	RGGWCCY	1 cut(s)	380
PshAI	GACNNNNGTC	1 cut(s)	680
PshBI	ATTAAT	1 cut(s)	1098
Psp124BI	GAGCTC	1 cut(s)	24
Psp5II	RGGWCCY	1 cut(s)	380
Psp6I	CCWGG	1 cut(s)	1181
PspFI	CCCAGC	1 cut(s)	301
PspGI	CCWGG	1 cut(s)	1181
PspN4I	GGNNCC	1 cut(s)	100
PspPI	GGNCC	2 cut(s)	98, 380
PspPPI	RGGWCCY	1 cut(s)	380
PstNI	CAGNNNCTG	1 cut(s)	1006
RsaI	GTAC	5 cut(s)	354, 412, 538, 1026, 1160
RsaNI	GTAC	5 cut(s)	353, 411, 537, 1025, 1159
RseI	CAYNNNNRTG	2 cut(s)	196, 933
SacI	GAGCTC	1 cut(s)	24
SaqAI	TTAA	3 cut(s)	687, 693, 1098
Sau96I	GGNCC	2 cut(s)	98, 380
ScaI	AGTACT	1 cut(s)	538
SchI	GAGTC	2 cut(s)	670, 1211
ScrFI	CCNGG	1 cut(s)	1183
SduI	GDGCHC	2 cut(s)	24, 465
SinI	GGWCC	2 cut(s)	98, 380
SmiMI	CAYNNNNRTG	2 cut(s)	196, 933
SmlI	CTYRAG	4 cut(s)	42, 528, 678, 908
SmoI	CTYRAG	4 cut(s)	42, 528, 678, 908
SspI	AATATT	2 cut(s)	1050, 1119
SspMI	CTAG	3 cut(s)	497, 1139, 1240
SstI	GAGCTC	1 cut(s)	24
StyD4I	CCNGG	1 cut(s)	1181
StyI	CCWWGG	1 cut(s)	993
TaaI	ACNGT	1 cut(s)	148
TatI	WGTACW	3 cut(s)	410, 536, 1158
TfiI	GAWTC	2 cut(s)	1003, 1106
Tru1I	TTAA	3 cut(s)	687, 693, 1098
Tru9I	TTAA	3 cut(s)	687, 693, 1098
TscAI	CASTG	2 cut(s)	109, 153
TspDTI	ATGAA	9 cut(s)	24, 27, 390, 580, 671, 854, 1004, 1074, 1113
TspRI	CASTG	2 cut(s)	109, 153
Van91I	CCANNNNNTGG	2 cut(s)	414, 887
VpaK11BI	GGWCC	2 cut(s)	98, 380
VspI	ATTAAT	1 cut(s)	1098
XapI	RAATTY	4 cut(s)	92, 707, 727, 1071
XceI	RCATGY	2 cut(s)	201, 267
XspI	CTAG	3 cut(s)	497, 1139, 1240
ZrmI	AGTACT	1 cut(s)	538
Zsp2I	ATGCAT	3 cut(s)	203, 265, 432

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.