Rmu_sc0006994.1_g000001

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0006994.1
Physical Location & Seq
Forward (+)
14271 .. 15380
1110 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0006994.1_g000001.1.cds

Sequence Viewer

Length: 999 bp
atgattttgattttgctgtttgctagtattgaatttcaacaagttgagcagagtatgattgaccaagaggtgttgaaggagtgcgttgatggagttggaaacccaacacctgaggtagaaaaccagctcaagaccaatttgtcctaccagcgggtccttcaggcacgccagggagtgccttatggtggtctaatccgcgttcaattgtggcctcctcctccgccgcgtgatgattatagggcaactgtgaggtatatagaatacacaataagccaacttaagaatggaatcgtttcacaacagatggtagattcggctaaggaaacggtacgccgccttagatcgaaaggatattccagcttagatgaggatgaagcaatcactctaaaggacagcattcacttccttggtaggctagaaagcaccccctctccctttagggagaggtttcttaactttgctgaagacgttccaagccgtgttcgctgcctccgtcaaatgcaggaaacattgattgatcagccaaatcttgtagagcaagagagacaatgcatagctgaaattcagaacagaaatctgcaagagttaaattaccctaatctgcagagtgttaatcctgaggttctgacagcgaagtgttccaaaaccaacgagaatattaaattacccttagctgacaatggaggagaaaggcagccagagttcgtgatatttgatgatgatgatgtagaaatctgcaaaaaacggaaaagaagagagatgaaggacttggaagaagcttatagtatacagacccaattggatgcaaaagttaatgatattgaggctcttaatatcaagttggaagagatcaatgctggaagagaaaaaaataaaagtgaggatcaggaagacttgacagctttacgtgtgcatgagaaaaagataaacaacagattcaagaagatggagttggctaggaaagctcaatcagaatttgacgaatttgatcgcctgtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

332

Amino Acids

38.54

Weight (kDa)

5.11

Isoelectric Point (pI)

57.32

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 139
AccI GTMKAC 1 cut(s) 787
AccII CGCG 2 cut(s) 198, 226
AciI CCGC 5 cut(s) 151, 196, 221, 224, 334
AclWI GGATC 1 cut(s) 891
AcsI RAATTY 4 cut(s) 32, 561, 974, 983
AcuI CTGAAG 2 cut(s) 143, 483
AfaI GTAC 1 cut(s) 330
AfiI CCNNNNNNNGG 2 cut(s) 150, 185
AflII CTTAAG 1 cut(s) 278
AflIII ACRYGT 1 cut(s) 907
AgsI TTSAA 5 cut(s) 32, 38, 76, 203, 940
AjnI CCWGG 1 cut(s) 168
AjuI GAANNNNNNNTTGG 2 cut(s) 935, 967
AluBI AGCT 7 cut(s) 127, 360, 557, 674, 779, 902, 965
AluI AGCT 7 cut(s) 127, 360, 557, 674, 779, 902, 965
Alw26I GTCTC 1 cut(s) 538
AlwI GGATC 1 cut(s) 891
AoxI GGCC 1 cut(s) 209
ApeKI GCWGC 2 cut(s) 486, 694
ApoI RAATTY 4 cut(s) 32, 561, 974, 983
Asp700I GAANNNNTTC 2 cut(s) 292, 468
AspS9I GGNCC 1 cut(s) 154
AvaII GGWCC 1 cut(s) 154
AxyI CCTNAGG 2 cut(s) 111, 618
BbsI GAAGAC 2 cut(s) 471, 897
BbvI GCAGC 2 cut(s) 473, 706
BccI CCATC 3 cut(s) 83, 298, 940
BceAI ACGGC 1 cut(s) 462
BciT130I CCWGG 1 cut(s) 170
BclI TGATCA 1 cut(s) 517
BcoDI GTCTC 1 cut(s) 538
BfaI CTAG 3 cut(s) 24, 416, 957
BfmI CTRYAG 1 cut(s) 602
BfrI CTTAAG 1 cut(s) 278
BisI GCNGC 4 cut(s) 224, 334, 487, 695
BlsI GCNGC 4 cut(s) 225, 335, 488, 696
Bme1390I CCNGG 1 cut(s) 170
Bme18I GGWCC 1 cut(s) 154
BmgT120I GGNCC 1 cut(s) 154
BmiI GGNNCC 1 cut(s) 155
BmrFI CCNGG 1 cut(s) 170
BmsI GCATC 1 cut(s) 793
BpiI GAAGAC 2 cut(s) 471, 897
Bpu10I CCTNAGC 2 cut(s) 318, 670
BpuEI CTTGAG 1 cut(s) 113
BsaAI YACGTR 1 cut(s) 908
BsaJI CCNNGG 2 cut(s) 169, 406
BsaXI ACNNNNNCTCC 2 cut(s) 415, 445
Bsc4I CCNNNNNNNGG 2 cut(s) 150, 185
Bse21I CCTNAGG 2 cut(s) 111, 618
BseBI CCWGG 1 cut(s) 170
BseDI CCNNGG 2 cut(s) 169, 406
BseGI GGATG 2 cut(s) 376, 808
BseLI CCNNNNNNNGG 2 cut(s) 150, 185
BseMII CTCAG 2 cut(s) 102, 609
BseRI GAGGAG 3 cut(s) 204, 207, 699
BseXI GCAGC 2 cut(s) 473, 706
Bsh1236I CGCG 2 cut(s) 198, 226
BshFI GGCC 1 cut(s) 211
BslI CCNNNNNNNGG 2 cut(s) 150, 185
BsmAI GTCTC 1 cut(s) 538
BsmI GAATGC 1 cut(s) 396
BsnI GGCC 1 cut(s) 211
Bsp143I GATC 5 cut(s) 341, 517, 849, 883, 988
BspACI CCGC 5 cut(s) 151, 196, 221, 224, 334
BspANI GGCC 1 cut(s) 211
BspCNI CTCAG 2 cut(s) 103, 610
BspFNI CGCG 2 cut(s) 198, 226
BspLI GGNNCC 1 cut(s) 155
BspMAI CTGCAG 1 cut(s) 606
BspPI GGATC 1 cut(s) 891
BspTI CTTAAG 1 cut(s) 278
BssECI CCNNGG 2 cut(s) 169, 406
BssMI GATC 5 cut(s) 341, 517, 849, 883, 988
BssNAI GTATAC 1 cut(s) 788
BssT1I CCWWGG 1 cut(s) 406
Bst1107I GTATAC 1 cut(s) 788
Bst2UI CCWGG 1 cut(s) 170
Bst4CI ACNGT 2 cut(s) 247, 328
Bst6I CTCTTC 3 cut(s) 748, 840, 856
BstAFI CTTAAG 1 cut(s) 278
BstBAI YACGTR 1 cut(s) 908
BstC8I GCNNGC 1 cut(s) 166
BstDEI CTNAG 6 cut(s) 111, 318, 338, 361, 618, 670
BstF5I GGATG 2 cut(s) 376, 808
BstFNI CGCG 2 cut(s) 198, 226
BstKTI GATC 5 cut(s) 344, 520, 852, 886, 991
BstMAI GTCTC 1 cut(s) 538
BstMBI GATC 5 cut(s) 341, 517, 849, 883, 988
BstMWI GCNNNNNNNGC 2 cut(s) 483, 962
BstNI CCWGG 1 cut(s) 170
BstSCI CCNGG 1 cut(s) 168
BstSFI CTRYAG 1 cut(s) 602
BstUI CGCG 2 cut(s) 198, 226
BstV1I GCAGC 2 cut(s) 473, 706
BstV2I GAAGAC 2 cut(s) 471, 897
BstZ17I GTATAC 1 cut(s) 788
Bsu36I CCTNAGG 2 cut(s) 111, 618
BsuRI GGCC 1 cut(s) 211
BtsCI GGATG 2 cut(s) 376, 808
Cac8I GCNNGC 1 cut(s) 166
Cfr13I GGNCC 1 cut(s) 154
Csp6I GTAC 1 cut(s) 329
CviAII CATG 1 cut(s) 914
CviQI GTAC 1 cut(s) 329
DdeI CTNAG 6 cut(s) 111, 318, 338, 361, 618, 670
DpnI GATC 5 cut(s) 343, 519, 851, 885, 990
DpnII GATC 5 cut(s) 341, 517, 849, 883, 988
DrdI GACNNNNNNGTC 1 cut(s) 139
DseDI GACNNNNNNGTC 1 cut(s) 139
Eam1104I CTCTTC 3 cut(s) 748, 840, 856
EarI CTCTTC 3 cut(s) 748, 840, 856
EciI GGCGGA 1 cut(s) 210
Eco130I CCWWGG 1 cut(s) 406
Eco47I GGWCC 1 cut(s) 154
Eco57I CTGAAG 2 cut(s) 143, 483
Eco81I CCTNAGG 2 cut(s) 111, 618
EcoO109I RGGNCCY 1 cut(s) 154
EcoRII CCWGG 1 cut(s) 168
EcoT14I CCWWGG 1 cut(s) 406
EcoT22I ATGCAT 1 cut(s) 554
ErhI CCWWGG 1 cut(s) 406
FaeI CATG 1 cut(s) 917
FaiI YATR 9 cut(s) 56, 183, 237, 255, 257, 554, 783, 788, 915
FatI CATG 1 cut(s) 913
FauI CCCGC 1 cut(s) 144
FbaI TGATCA 1 cut(s) 517
FblI GTMKAC 1 cut(s) 787
Fnu4HI GCNGC 4 cut(s) 224, 334, 487, 695
FokI GGATG 2 cut(s) 383, 815
Fsp4HI GCNGC 4 cut(s) 224, 334, 487, 695
FspBI CTAG 3 cut(s) 24, 416, 957
GluI GCNGC 4 cut(s) 224, 334, 487, 695
HaeIII GGCC 1 cut(s) 211
Hin1II CATG 1 cut(s) 917
HindIII AAGCTT 1 cut(s) 777
HinfI GANTC 3 cut(s) 288, 311, 936
Hpy166II GTNNAC 1 cut(s) 788
Hpy188I TCNGA 3 cut(s) 567, 627, 973
Hpy188III TCNNGA 5 cut(s) 130, 617, 706, 887, 940
Hpy8I GTNNAC 1 cut(s) 788
HpyAV CCTTC 3 cut(s) 70, 167, 757
HpyCH4III ACNGT 2 cut(s) 247, 328
HpyCH4IV ACGT 2 cut(s) 468, 907
HpyCH4V TGCA 7 cut(s) 502, 552, 580, 604, 738, 806, 913
HpyF10VI GCNNNNNNNGC 2 cut(s) 483, 962
HpyF3I CTNAG 6 cut(s) 111, 318, 338, 361, 618, 670
HpySE526I ACGT 2 cut(s) 468, 907
Hsp92II CATG 1 cut(s) 917
Ksp22I TGATCA 1 cut(s) 517
Kzo9I GATC 5 cut(s) 341, 517, 849, 883, 988
Lsp1109I GCAGC 2 cut(s) 473, 706
LweI GCATC 1 cut(s) 793
MaeI CTAG 3 cut(s) 24, 416, 957
MaeII ACGT 2 cut(s) 468, 907
MalI GATC 5 cut(s) 343, 519, 851, 885, 990
MboI GATC 5 cut(s) 341, 517, 849, 883, 988
MboII GAAGA 7 cut(s) 476, 765, 785, 857, 873, 902, 955
MfeI CAATTG 2 cut(s) 203, 797
MluCI AATT 9 cut(s) 32, 136, 203, 561, 589, 662, 797, 974, 983
MmeI TCCRAC 2 cut(s) 76, 822
Mph1103I ATGCAT 1 cut(s) 554
MroXI GAANNNNTTC 2 cut(s) 292, 468
MseI TTAA 7 cut(s) 279, 453, 587, 612, 660, 813, 831
MspA1I CMGCKG 1 cut(s) 151
MspCI CTTAAG 1 cut(s) 278
MspR9I CCNGG 1 cut(s) 170
MunI CAATTG 2 cut(s) 203, 797
Mva1269I GAATGC 1 cut(s) 396
MvaI CCWGG 1 cut(s) 170
MvnI CGCG 2 cut(s) 198, 226
MwoI GCNNNNNNNGC 2 cut(s) 483, 962
NdeII GATC 5 cut(s) 341, 517, 849, 883, 988
NlaIII CATG 1 cut(s) 917
NlaIV GGNNCC 1 cut(s) 155
NsiI ATGCAT 1 cut(s) 554
PcsI WCGNNNNNNNCGW 1 cut(s) 490
PctI GAATGC 1 cut(s) 396
PdmI GAANNNNTTC 2 cut(s) 292, 468
PfeI GAWTC 3 cut(s) 288, 311, 936
PkrI GCNGC 4 cut(s) 225, 335, 488, 696
Ppu21I YACGTR 1 cut(s) 908
PpuMI RGGWCCY 1 cut(s) 154
Psp5II RGGWCCY 1 cut(s) 154
Psp6I CCWGG 1 cut(s) 168
PspGI CCWGG 1 cut(s) 168
PspN4I GGNNCC 1 cut(s) 155
PspPI GGNCC 1 cut(s) 154
PspPPI RGGWCCY 1 cut(s) 154
PstI CTGCAG 1 cut(s) 606
RsaI GTAC 1 cut(s) 330
RsaNI GTAC 1 cut(s) 329
SaqAI TTAA 7 cut(s) 279, 453, 587, 612, 660, 813, 831
SatI GCNGC 4 cut(s) 224, 334, 487, 695
Sau3AI GATC 5 cut(s) 341, 517, 849, 883, 988
Sau96I GGNCC 1 cut(s) 154
ScrFI CCNGG 1 cut(s) 170
SfaNI GCATC 1 cut(s) 793
SfcI CTRYAG 1 cut(s) 602
SinI GGWCC 1 cut(s) 154
SmlI CTYRAG 2 cut(s) 128, 278
SmoI CTYRAG 2 cut(s) 128, 278
Sse9I AATT 9 cut(s) 32, 136, 203, 561, 589, 662, 797, 974, 983
SsiI CCGC 5 cut(s) 151, 196, 221, 224, 334
SspI AATATT 1 cut(s) 658
SspMI CTAG 3 cut(s) 24, 416, 957
StyD4I CCNGG 1 cut(s) 168
StyI CCWWGG 1 cut(s) 406
TaaI ACNGT 2 cut(s) 247, 328
TaiI ACGT 2 cut(s) 471, 910
TaqI TCGA 1 cut(s) 344
TasI AATT 9 cut(s) 32, 136, 203, 561, 589, 662, 797, 974, 983
TauI GCSGC 2 cut(s) 226, 336
TfiI GAWTC 3 cut(s) 288, 311, 936
Tru1I TTAA 7 cut(s) 279, 453, 587, 612, 660, 813, 831
Tru9I TTAA 7 cut(s) 279, 453, 587, 612, 660, 813, 831
TseI GCWGC 2 cut(s) 486, 694
TspDTI ATGAA 2 cut(s) 387, 776
TspGWI ACGGA 2 cut(s) 482, 760
Vha464I CTTAAG 1 cut(s) 278
VpaK11BI GGWCC 1 cut(s) 154
XapI RAATTY 4 cut(s) 32, 561, 974, 983
XcmI CCANNNNNNNNNTGG 1 cut(s) 281
XmiI GTMKAC 1 cut(s) 787
XmnI GAANNNNTTC 2 cut(s) 292, 468
XspI CTAG 3 cut(s) 24, 416, 957
Zsp2I ATGCAT 1 cut(s) 554
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.