Rh5BG366200

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5B
Physical Location & Seq
Reverse (-)
57444218 .. 57444499
282 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5BG366200.1

Sequence Viewer

Length: 282 bp
ATGGTGATGATGCAGAAATCTGCCAAAACGGAAAAGAAGAGAGATGGGGACTTGGAAGAAGCTTATAGTATACAGACCCAATTGGATGCAAAAGTTAATGATATTGAGGGACTTAATATCAAGTTGGAAGAGATCAATGCTGGAAGAGAAAAAGATAAATGTGAGGATCAGGAAGACTTGACAGCTTTACTTGTGCATAAGAAAAAGATAAACAACATATTCAAGAAGATGGAGTTGGCTAGGAACGTTCAATCAGAATTTGACGAATTTGATCGCCTGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

93

Amino Acids

10.85

Weight (kDa)

5.07

Isoelectric Point (pI)

52.84

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 70
AclI AACGTT 1 cut(s) 246
AclWI GGATC 1 cut(s) 174
AcsI RAATTY 2 cut(s) 257, 266
AgsI TTSAA 2 cut(s) 223, 251
AjuI GAANNNNNNNTTGG 2 cut(s) 218, 250
AluBI AGCT 2 cut(s) 62, 185
AluI AGCT 2 cut(s) 62, 185
AlwI GGATC 1 cut(s) 174
ApoI RAATTY 2 cut(s) 257, 266
AsuHPI GGTGA 1 cut(s) 16
BbsI GAAGAC 1 cut(s) 180
BccI CCATC 2 cut(s) 38, 223
BfaI CTAG 1 cut(s) 240
BmsI GCATC 1 cut(s) 76
BpiI GAAGAC 1 cut(s) 180
BseGI GGATG 1 cut(s) 91
BslFI GGGAC 2 cut(s) 62, 123
BsmFI GGGAC 2 cut(s) 62, 123
Bsp143I GATC 3 cut(s) 132, 166, 271
BspPI GGATC 1 cut(s) 174
BssMI GATC 3 cut(s) 132, 166, 271
BssNAI GTATAC 1 cut(s) 71
Bst1107I GTATAC 1 cut(s) 71
Bst6I CTCTTC 3 cut(s) 32, 123, 139
BstF5I GGATG 1 cut(s) 91
BstKTI GATC 3 cut(s) 135, 169, 274
BstMBI GATC 3 cut(s) 132, 166, 271
BstV2I GAAGAC 1 cut(s) 180
BstZ17I GTATAC 1 cut(s) 71
BtsCI GGATG 1 cut(s) 91
CviJI RGCY 3 cut(s) 62, 185, 239
CviKI_1 RGCY 3 cut(s) 62, 185, 239
DpnI GATC 3 cut(s) 134, 168, 273
DpnII GATC 3 cut(s) 132, 166, 271
Eam1104I CTCTTC 3 cut(s) 32, 123, 139
EarI CTCTTC 3 cut(s) 32, 123, 139
FaiI YATR 4 cut(s) 66, 71, 198, 218
FaqI GGGAC 2 cut(s) 62, 123
FblI GTMKAC 1 cut(s) 70
FokI GGATG 1 cut(s) 98
FspBI CTAG 1 cut(s) 240
HindIII AAGCTT 1 cut(s) 60
HphI GGTGA 1 cut(s) 16
Hpy166II GTNNAC 1 cut(s) 71
Hpy188I TCNGA 1 cut(s) 256
Hpy188III TCNNGA 2 cut(s) 170, 223
Hpy8I GTNNAC 1 cut(s) 71
HpyCH4IV ACGT 1 cut(s) 246
HpyCH4V TGCA 3 cut(s) 13, 89, 196
HpySE526I ACGT 1 cut(s) 246
Kzo9I GATC 3 cut(s) 132, 166, 271
LpnPI CCDG 2 cut(s) 126, 155
LweI GCATC 1 cut(s) 76
MaeI CTAG 1 cut(s) 240
MaeII ACGT 1 cut(s) 246
MalI GATC 3 cut(s) 134, 168, 273
MboI GATC 3 cut(s) 132, 166, 271
MboII GAAGA 6 cut(s) 49, 68, 140, 156, 185, 238
MfeI CAATTG 1 cut(s) 80
MluCI AATT 3 cut(s) 80, 257, 266
MmeI TCCRAC 1 cut(s) 105
MnlI CCTC 2 cut(s) 100, 157
MseI TTAA 2 cut(s) 96, 114
MunI CAATTG 1 cut(s) 80
NdeII GATC 3 cut(s) 132, 166, 271
Psp1406I AACGTT 1 cut(s) 246
SaqAI TTAA 2 cut(s) 96, 114
Sau3AI GATC 3 cut(s) 132, 166, 271
SetI ASST 3 cut(s) 64, 187, 249
SfaNI GCATC 1 cut(s) 76
SgeI CNNG 8 cut(s) 64, 133, 153, 182, 190, 203, 235, 252
Sse9I AATT 3 cut(s) 80, 257, 266
SspMI CTAG 1 cut(s) 240
TaiI ACGT 1 cut(s) 249
TasI AATT 3 cut(s) 80, 257, 266
Tru1I TTAA 2 cut(s) 96, 114
Tru9I TTAA 2 cut(s) 96, 114
TspGWI ACGGA 1 cut(s) 44
XapI RAATTY 2 cut(s) 257, 266
XmiI GTMKAC 1 cut(s) 70
XspI CTAG 1 cut(s) 240
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.