Rroxscaffold_6G00424070

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000006
Physical Location & Seq
Forward (+)
45298697 .. 45303688
4992 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_6G00424070.1

Sequence Viewer

Length: 297 bp
ATGGCTTCATCATCGAGGACAAGGGATCGGTTTAGTATTGAATTTCAACAAGTTGAGCAAAGTATGATTGACAAAGAGGTGTTGGAGGAGTGCGTTGGTGGAGTTGGAAACCGAACACCTGAGGTAGAAAATATAGTCGGATCCTCTACCCATTATTCTCCCACCTTGATAAACCAGCTCAAGACCGATTTGTCCTATCTGCGGGCATGCCAGGGAGTGCCAAATGGTCGTCTAATCCGCATTCAATCGTGGTCTCCTCCTCCGCCCCGTGATGATTATAGGGTGATAGGAGCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

98

Amino Acids

10.98

Weight (kDa)

5.76

Isoelectric Point (pI)

64.68

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 190
AciI CCGC 3 cut(s) 202, 238, 263
AclWI GGATC 3 cut(s) 33, 135, 148
AcsI RAATTY 1 cut(s) 41
AfiI CCNNNNNNNGG 1 cut(s) 201
AgsI TTSAA 3 cut(s) 41, 47, 245
AjnI CCWGG 1 cut(s) 210
AluBI AGCT 1 cut(s) 178
AluI AGCT 1 cut(s) 178
Alw26I GTCTC 1 cut(s) 258
AlwI GGATC 3 cut(s) 33, 135, 148
ApoI RAATTY 1 cut(s) 41
AsuHPI GGTGA 1 cut(s) 295
AxyI CCTNAGG 1 cut(s) 120
BamHI GGATCC 1 cut(s) 140
BciT130I CCWGG 1 cut(s) 212
BcoDI GTCTC 1 cut(s) 258
Bme1390I CCNGG 1 cut(s) 212
BmiI GGNNCC 1 cut(s) 142
BmrFI CCNGG 1 cut(s) 212
BpuEI CTTGAG 1 cut(s) 164
BsaI GGTCTC 1 cut(s) 258
BsaJI CCNNGG 1 cut(s) 211
Bsc4I CCNNNNNNNGG 1 cut(s) 201
Bse21I CCTNAGG 1 cut(s) 120
BseBI CCWGG 1 cut(s) 212
BseDI CCNNGG 1 cut(s) 211
BseLI CCNNNNNNNGG 1 cut(s) 201
BseMII CTCAG 1 cut(s) 111
BseRI GAGGAG 3 cut(s) 101, 246, 249
BslI CCNNNNNNNGG 1 cut(s) 201
BsmAI GTCTC 1 cut(s) 258
BsmI GAATGC 1 cut(s) 240
Bso31I GGTCTC 1 cut(s) 258
Bsp143I GATC 2 cut(s) 25, 140
BspACI CCGC 3 cut(s) 202, 238, 263
BspCNI CTCAG 1 cut(s) 112
BspLI GGNNCC 1 cut(s) 142
BspPI GGATC 3 cut(s) 33, 135, 148
BspTNI GGTCTC 1 cut(s) 258
BssECI CCNNGG 1 cut(s) 211
BssMI GATC 2 cut(s) 25, 140
Bst2UI CCWGG 1 cut(s) 212
BstC8I GCNNGC 2 cut(s) 204, 208
BstDEI CTNAG 1 cut(s) 120
BstKTI GATC 2 cut(s) 28, 143
BstMAI GTCTC 1 cut(s) 258
BstMBI GATC 2 cut(s) 25, 140
BstNI CCWGG 1 cut(s) 212
BstNSI RCATGY 1 cut(s) 210
BstSCI CCNGG 1 cut(s) 210
BstX2I RGATCY 1 cut(s) 140
BstYI RGATCY 1 cut(s) 140
Bsu36I CCTNAGG 1 cut(s) 120
Cac8I GCNNGC 2 cut(s) 204, 208
CviAII CATG 1 cut(s) 207
CviJI RGCY 2 cut(s) 5, 178
CviKI_1 RGCY 2 cut(s) 5, 178
DdeI CTNAG 1 cut(s) 120
DpnI GATC 2 cut(s) 27, 142
DpnII GATC 2 cut(s) 25, 140
DrdI GACNNNNNNGTC 1 cut(s) 190
DseDI GACNNNNNNGTC 1 cut(s) 190
EciI GGCGGA 1 cut(s) 252
Eco31I GGTCTC 1 cut(s) 258
Eco81I CCTNAGG 1 cut(s) 120
EcoRII CCWGG 1 cut(s) 210
FaeI CATG 1 cut(s) 210
FaiI YATR 5 cut(s) 65, 134, 208, 279, 295
FatI CATG 1 cut(s) 206
FauI CCCGC 1 cut(s) 195
Hin1II CATG 1 cut(s) 210
HphI GGTGA 1 cut(s) 295
Hpy188I TCNGA 1 cut(s) 140
Hpy188III TCNNGA 1 cut(s) 181
HpyF3I CTNAG 1 cut(s) 120
Hsp92II CATG 1 cut(s) 210
Kzo9I GATC 2 cut(s) 25, 140
LmnI GCTCC 1 cut(s) 290
LpnPI CCDG 4 cut(s) 132, 188, 197, 224
MalI GATC 2 cut(s) 27, 142
MboI GATC 2 cut(s) 25, 140
MflI RGATCY 1 cut(s) 140
MluCI AATT 1 cut(s) 41
MmeI TCCRAC 3 cut(s) 63, 85, 118
MnlI CCTC 7 cut(s) 9, 70, 79, 115, 154, 267, 270
MspR9I CCNGG 1 cut(s) 212
Mva1269I GAATGC 1 cut(s) 240
MvaI CCWGG 1 cut(s) 212
NdeII GATC 2 cut(s) 25, 140
NlaIII CATG 1 cut(s) 210
NlaIV GGNNCC 1 cut(s) 142
NspI RCATGY 1 cut(s) 210
PaeI GCATGC 1 cut(s) 210
PctI GAATGC 1 cut(s) 240
Psp6I CCWGG 1 cut(s) 210
PspGI CCWGG 1 cut(s) 210
PspN4I GGNNCC 1 cut(s) 142
PsuI RGATCY 1 cut(s) 140
Sau3AI GATC 2 cut(s) 25, 140
ScrFI CCNGG 1 cut(s) 212
SetI ASST 5 cut(s) 81, 121, 126, 167, 180
SmlI CTYRAG 1 cut(s) 179
SmoI CTYRAG 1 cut(s) 179
SphI GCATGC 1 cut(s) 210
Sse9I AATT 1 cut(s) 41
SsiI CCGC 3 cut(s) 202, 238, 263
StyD4I CCNGG 1 cut(s) 210
TaqI TCGA 1 cut(s) 14
TaqII GACCGA 1 cut(s) 200
TasI AATT 1 cut(s) 41
XapI RAATTY 1 cut(s) 41
XceI RCATGY 1 cut(s) 210
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.