Rh6AG051900

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6A
Physical Location & Seq
Forward (+)
7483431 .. 7483655
225 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6AG051900.1

Sequence Viewer

Length: 225 bp
ATGGAGGACTTGGAAGAAGCTTATAGTATACAGACCCAATTGGATGCAAAAGTTAATGATATTGAGGTGCTTAATATCAAGTTGGAAGAGATCAATGCTGGAAGAGAAAAAGACAAAAGTGAGGATCAGGGAGACTTGACAACTTTACTTGTGCATGAGAAAAAGATAAACAACAGATTCAAGAAGATGGAGTTGGCTAGGAAAGTTCAATCAGAATTTGACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

74

Amino Acids

8.64

Weight (kDa)

4.77

Isoelectric Point (pI)

45.64

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 28
AclWI GGATC 1 cut(s) 132
AcsI RAATTY 1 cut(s) 215
AgsI TTSAA 2 cut(s) 181, 209
AjuI GAANNNNNNNTTGG 2 cut(s) 176, 208
AluBI AGCT 1 cut(s) 20
AluI AGCT 1 cut(s) 20
Alw26I GTCTC 1 cut(s) 126
AlwI GGATC 1 cut(s) 132
ApoI RAATTY 1 cut(s) 215
BccI CCATC 1 cut(s) 181
BcoDI GTCTC 1 cut(s) 126
BfaI CTAG 1 cut(s) 198
BmsI GCATC 1 cut(s) 34
BseGI GGATG 1 cut(s) 49
BsmAI GTCTC 1 cut(s) 126
Bsp143I GATC 2 cut(s) 90, 124
BspPI GGATC 1 cut(s) 132
BssMI GATC 2 cut(s) 90, 124
BssNAI GTATAC 1 cut(s) 29
Bst1107I GTATAC 1 cut(s) 29
Bst6I CTCTTC 2 cut(s) 81, 97
BstF5I GGATG 1 cut(s) 49
BstKTI GATC 2 cut(s) 93, 127
BstMAI GTCTC 1 cut(s) 126
BstMBI GATC 2 cut(s) 90, 124
BstZ17I GTATAC 1 cut(s) 29
BtsCI GGATG 1 cut(s) 49
CviAII CATG 1 cut(s) 155
CviJI RGCY 2 cut(s) 20, 197
CviKI_1 RGCY 2 cut(s) 20, 197
DpnI GATC 2 cut(s) 92, 126
DpnII GATC 2 cut(s) 90, 124
Eam1104I CTCTTC 2 cut(s) 81, 97
EarI CTCTTC 2 cut(s) 81, 97
FaeI CATG 1 cut(s) 158
FaiI YATR 3 cut(s) 24, 29, 156
FatI CATG 1 cut(s) 154
FblI GTMKAC 1 cut(s) 28
FokI GGATG 1 cut(s) 56
FspBI CTAG 1 cut(s) 198
Hin1II CATG 1 cut(s) 158
HindIII AAGCTT 1 cut(s) 18
HinfI GANTC 1 cut(s) 177
Hpy166II GTNNAC 1 cut(s) 29
Hpy188I TCNGA 1 cut(s) 214
Hpy188III TCNNGA 1 cut(s) 181
Hpy8I GTNNAC 1 cut(s) 29
HpyCH4V TGCA 2 cut(s) 47, 154
Hsp92II CATG 1 cut(s) 158
Kzo9I GATC 2 cut(s) 90, 124
LpnPI CCDG 2 cut(s) 84, 113
LweI GCATC 1 cut(s) 34
MaeI CTAG 1 cut(s) 198
MalI GATC 2 cut(s) 92, 126
MboI GATC 2 cut(s) 90, 124
MboII GAAGA 4 cut(s) 26, 98, 114, 196
MfeI CAATTG 1 cut(s) 38
MluCI AATT 2 cut(s) 38, 215
MmeI TCCRAC 1 cut(s) 63
MnlI CCTC 2 cut(s) 58, 115
MseI TTAA 2 cut(s) 54, 72
MunI CAATTG 1 cut(s) 38
NdeII GATC 2 cut(s) 90, 124
NlaIII CATG 1 cut(s) 158
PfeI GAWTC 1 cut(s) 177
SaqAI TTAA 2 cut(s) 54, 72
Sau3AI GATC 2 cut(s) 90, 124
SetI ASST 2 cut(s) 22, 69
SfaNI GCATC 1 cut(s) 34
SgeI CNNG 9 cut(s) 22, 91, 111, 140, 148, 161, 167, 193, 210
Sse9I AATT 2 cut(s) 38, 215
SspMI CTAG 1 cut(s) 198
TasI AATT 2 cut(s) 38, 215
TfiI GAWTC 1 cut(s) 177
Tru1I TTAA 2 cut(s) 54, 72
Tru9I TTAA 2 cut(s) 54, 72
XapI RAATTY 1 cut(s) 215
XmiI GTMKAC 1 cut(s) 28
XspI CTAG 1 cut(s) 198
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.