Rmu_sc0009084.1_g000018

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0009084.1
Physical Location & Seq
Reverse (-)
77785 .. 78795
1011 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0009084.1_g000018.1.cds

Sequence Viewer

Length: 498 bp
atgattttgattttgctgtttgcaagtattgaatttcaacaagttgagcagagtatgattgaccaagaggtgttgagggagcgcgtcgatggagttggaaacccaacacctgaggtagaaaaccagctcaagaccaatttgtcctaccagcgggtccttcaggcacgccagggagtgccttatggtggtctaatccgcgttcaattgtggcctcctcctccgccccgtgatgattatagggcaactgtgagaagagagatgaaggacttggaagaagcttatagtatacagacccaattggatgcaaaagttaatgatattgaggctcttaatatcaagttggaagagatcaatgctggaagagaaaaaaataaaagtgaggatcaggaagacttgacagctttacgtgtgcatgagaaaaagataaacaacagattcaagaagatggagttggctaggaaagctcaatcagaatttgacgaatttgatcgcctgtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

165

Amino Acids

19.27

Weight (kDa)

5.13

Isoelectric Point (pI)

52.64

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 139
AccI GTMKAC 1 cut(s) 286
AccII CGCG 2 cut(s) 84, 198
AciI CCGC 3 cut(s) 151, 196, 221
AclWI GGATC 1 cut(s) 390
AcsI RAATTY 3 cut(s) 32, 473, 482
AcuI CTGAAG 1 cut(s) 143
AfiI CCNNNNNNNGG 2 cut(s) 150, 185
AflIII ACRYGT 1 cut(s) 406
AgsI TTSAA 4 cut(s) 32, 38, 203, 439
AjnI CCWGG 1 cut(s) 168
AjuI GAANNNNNNNTTGG 2 cut(s) 434, 466
AluBI AGCT 4 cut(s) 127, 278, 401, 464
AluI AGCT 4 cut(s) 127, 278, 401, 464
AlwI GGATC 1 cut(s) 390
AoxI GGCC 1 cut(s) 209
ApoI RAATTY 3 cut(s) 32, 473, 482
AspLEI GCGC 1 cut(s) 84
AspS9I GGNCC 1 cut(s) 154
AvaII GGWCC 1 cut(s) 154
AxyI CCTNAGG 1 cut(s) 111
BbsI GAAGAC 1 cut(s) 396
BccI CCATC 2 cut(s) 83, 439
BciT130I CCWGG 1 cut(s) 170
BfaI CTAG 1 cut(s) 456
Bme1390I CCNGG 1 cut(s) 170
Bme18I GGWCC 1 cut(s) 154
BmgT120I GGNCC 1 cut(s) 154
BmiI GGNNCC 1 cut(s) 155
BmrFI CCNGG 1 cut(s) 170
BmsI GCATC 1 cut(s) 292
BpiI GAAGAC 1 cut(s) 396
BpuEI CTTGAG 1 cut(s) 113
BsaAI YACGTR 1 cut(s) 407
BsaJI CCNNGG 1 cut(s) 169
Bsc4I CCNNNNNNNGG 2 cut(s) 150, 185
Bse21I CCTNAGG 1 cut(s) 111
BseBI CCWGG 1 cut(s) 170
BseDI CCNNGG 1 cut(s) 169
BseGI GGATG 1 cut(s) 307
BseLI CCNNNNNNNGG 2 cut(s) 150, 185
BseMII CTCAG 1 cut(s) 102
BseRI GAGGAG 2 cut(s) 204, 207
Bsh1236I CGCG 2 cut(s) 84, 198
BshFI GGCC 1 cut(s) 211
BslI CCNNNNNNNGG 2 cut(s) 150, 185
BsnI GGCC 1 cut(s) 211
Bsp143I GATC 3 cut(s) 348, 382, 487
BspACI CCGC 3 cut(s) 151, 196, 221
BspANI GGCC 1 cut(s) 211
BspCNI CTCAG 1 cut(s) 103
BspFNI CGCG 2 cut(s) 84, 198
BspLI GGNNCC 1 cut(s) 155
BspPI GGATC 1 cut(s) 390
BssECI CCNNGG 1 cut(s) 169
BssMI GATC 3 cut(s) 348, 382, 487
BssNAI GTATAC 1 cut(s) 287
Bst1107I GTATAC 1 cut(s) 287
Bst2UI CCWGG 1 cut(s) 170
Bst4CI ACNGT 1 cut(s) 247
Bst6I CTCTTC 3 cut(s) 247, 339, 355
BstBAI YACGTR 1 cut(s) 407
BstC8I GCNNGC 1 cut(s) 166
BstDEI CTNAG 1 cut(s) 111
BstF5I GGATG 1 cut(s) 307
BstFNI CGCG 2 cut(s) 84, 198
BstHHI GCGC 1 cut(s) 84
BstKTI GATC 3 cut(s) 351, 385, 490
BstMBI GATC 3 cut(s) 348, 382, 487
BstMWI GCNNNNNNNGC 1 cut(s) 461
BstNI CCWGG 1 cut(s) 170
BstSCI CCNGG 1 cut(s) 168
BstUI CGCG 2 cut(s) 84, 198
BstV2I GAAGAC 1 cut(s) 396
BstZ17I GTATAC 1 cut(s) 287
Bsu36I CCTNAGG 1 cut(s) 111
BsuRI GGCC 1 cut(s) 211
BtsCI GGATG 1 cut(s) 307
Cac8I GCNNGC 1 cut(s) 166
CfoI GCGC 1 cut(s) 84
Cfr13I GGNCC 1 cut(s) 154
CseI GACGC 1 cut(s) 73
CviAII CATG 1 cut(s) 413
CviJI RGCY 7 cut(s) 127, 211, 278, 326, 401, 455, 464
CviKI_1 RGCY 7 cut(s) 127, 211, 278, 326, 401, 455, 464
DdeI CTNAG 1 cut(s) 111
DpnI GATC 3 cut(s) 350, 384, 489
DpnII GATC 3 cut(s) 348, 382, 487
DrdI GACNNNNNNGTC 1 cut(s) 139
DseDI GACNNNNNNGTC 1 cut(s) 139
Eam1104I CTCTTC 3 cut(s) 247, 339, 355
EarI CTCTTC 3 cut(s) 247, 339, 355
EciI GGCGGA 1 cut(s) 210
Eco47I GGWCC 1 cut(s) 154
Eco57I CTGAAG 1 cut(s) 143
Eco81I CCTNAGG 1 cut(s) 111
EcoO109I RGGNCCY 1 cut(s) 154
EcoRII CCWGG 1 cut(s) 168
FaeI CATG 1 cut(s) 416
FaiI YATR 6 cut(s) 56, 183, 237, 282, 287, 414
FatI CATG 1 cut(s) 412
FauI CCCGC 1 cut(s) 144
FblI GTMKAC 1 cut(s) 286
FokI GGATG 1 cut(s) 314
FspBI CTAG 1 cut(s) 456
GlaI GCGC 1 cut(s) 83
HaeIII GGCC 1 cut(s) 211
HgaI GACGC 1 cut(s) 73
HhaI GCGC 1 cut(s) 84
Hin1II CATG 1 cut(s) 416
Hin6I GCGC 1 cut(s) 82
HinP1I GCGC 1 cut(s) 82
HindIII AAGCTT 1 cut(s) 276
HinfI GANTC 1 cut(s) 435
Hpy166II GTNNAC 1 cut(s) 287
Hpy188I TCNGA 1 cut(s) 472
Hpy188III TCNNGA 3 cut(s) 130, 386, 439
Hpy8I GTNNAC 1 cut(s) 287
Hpy99I CGWCG 1 cut(s) 89
HpyAV CCTTC 2 cut(s) 167, 256
HpyCH4III ACNGT 1 cut(s) 247
HpyCH4IV ACGT 1 cut(s) 406
HpyCH4V TGCA 3 cut(s) 23, 305, 412
HpyF10VI GCNNNNNNNGC 1 cut(s) 461
HpyF3I CTNAG 1 cut(s) 111
HpySE526I ACGT 1 cut(s) 406
Hsp92II CATG 1 cut(s) 416
HspAI GCGC 1 cut(s) 82
Kzo9I GATC 3 cut(s) 348, 382, 487
LmnI GCTCC 1 cut(s) 79
LpnPI CCDG 8 cut(s) 123, 137, 146, 155, 161, 182, 342, 371
LweI GCATC 1 cut(s) 292
MaeI CTAG 1 cut(s) 456
MaeII ACGT 1 cut(s) 406
MalI GATC 3 cut(s) 350, 384, 489
MboI GATC 3 cut(s) 348, 382, 487
MboII GAAGA 6 cut(s) 264, 284, 356, 372, 401, 454
MfeI CAATTG 2 cut(s) 203, 296
MluCI AATT 6 cut(s) 32, 136, 203, 296, 473, 482
MmeI TCCRAC 2 cut(s) 76, 321
MnlI CCTC 8 cut(s) 61, 69, 106, 222, 225, 228, 316, 373
MseI TTAA 2 cut(s) 312, 330
MspA1I CMGCKG 1 cut(s) 151
MspR9I CCNGG 1 cut(s) 170
MunI CAATTG 2 cut(s) 203, 296
MvaI CCWGG 1 cut(s) 170
MvnI CGCG 2 cut(s) 84, 198
MwoI GCNNNNNNNGC 1 cut(s) 461
NdeII GATC 3 cut(s) 348, 382, 487
NlaIII CATG 1 cut(s) 416
NlaIV GGNNCC 1 cut(s) 155
PfeI GAWTC 1 cut(s) 435
Ppu21I YACGTR 1 cut(s) 407
PpuMI RGGWCCY 1 cut(s) 154
Psp5II RGGWCCY 1 cut(s) 154
Psp6I CCWGG 1 cut(s) 168
PspGI CCWGG 1 cut(s) 168
PspN4I GGNNCC 1 cut(s) 155
PspPI GGNCC 1 cut(s) 154
PspPPI RGGWCCY 1 cut(s) 154
SaqAI TTAA 2 cut(s) 312, 330
Sau3AI GATC 3 cut(s) 348, 382, 487
Sau96I GGNCC 1 cut(s) 154
ScrFI CCNGG 1 cut(s) 170
SetI ASST 8 cut(s) 72, 112, 117, 129, 280, 403, 409, 466
SfaNI GCATC 1 cut(s) 292
SinI GGWCC 1 cut(s) 154
SmlI CTYRAG 1 cut(s) 128
SmoI CTYRAG 1 cut(s) 128
Sse9I AATT 6 cut(s) 32, 136, 203, 296, 473, 482
SsiI CCGC 3 cut(s) 151, 196, 221
SspMI CTAG 1 cut(s) 456
StyD4I CCNGG 1 cut(s) 168
TaaI ACNGT 1 cut(s) 247
TaiI ACGT 1 cut(s) 409
TaqI TCGA 1 cut(s) 87
TasI AATT 6 cut(s) 32, 136, 203, 296, 473, 482
TfiI GAWTC 1 cut(s) 435
Tru1I TTAA 2 cut(s) 312, 330
Tru9I TTAA 2 cut(s) 312, 330
TspDTI ATGAA 1 cut(s) 275
VpaK11BI GGWCC 1 cut(s) 154
XapI RAATTY 3 cut(s) 32, 473, 482
XmiI GTMKAC 1 cut(s) 286
XspI CTAG 1 cut(s) 456
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.