Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0007021.1

Orthogroup ID

OG0004137

Physical Location & Seq

Genomic Coordinates Forward (+)

49640 .. 50902

Gene Structure 1263 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0007021.1_g000016.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 633 bp

atgcaaatttcaaattgtgctgctgttacattgttggcttttttattgagcctacaaggagcttttgggatcagatttgtgatcgacagagatgaatgcttctctcataatgttttgtatgaaggagatactgtccacctctcttttgttgtaattaaggttgatgcatcttggcattatactcaagacggtgttgatctcctggtgaaggggccttctggtgagcagatacatgagtttcgtgataagacaagcgagaaattcgagtttgtcactcatcacaaaggaatccatcagttttgtttcaccaacaagtcaccttatcatgaaaccattgactttgacttacatgtcagccattttacatactatgatcagcatgcaagagatgagcattttaaccctttgttagatcagataacaaagttagaggaagctctttacaacattcagtttgagcagcattggcttgaggctcagactgaacgccaggcaatagtgaacgacgcaatgagccggagggcgattcacaaggccttttttgaatcagcaggacttgttggtgccagtgttctccaaatttaccttcttcgccgcctctttgaacggaagcttgggacgtccagagtctga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Cellulose_synt EMP24_GP25L

Protein Analysis

210

Amino Acids

24.38

Weight (kDa)

5.93

Isoelectric Point (pI)

36.99

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004137)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G07680
fragaria_vesca	FvH4_3g42910 FvH4_3g42910 FvH4_3g42910 FvH4_6g40540 FvH4_6g40540
malus_domestica	MD03G1028700.v1.1 MD09G1128600.v1.1 MD17G1118000.v1.1
prunus_persica	Prupe.3G196600_v2.0.a1 Prupe.3G196600_v2.0.a1 Prupe.6G024700_v2.0.a1 Prupe.6G024700_v2.0.a1
pyrus_communis	pycom09g05220 pycom17g10850
rosa_chinensis	RchiOBHm_Chr2g0155801 RchiOBHm_Chr5g0076951
rosa_laevigata	RLG00000020865 RLG00000036636
rosa_multiflora	Rmu_sc0003417.1_g000010 Rmu_sc0007021.1_g000016 Rmu_sc0017500.1_g000001
rosa_roxburghii	Rroxscaffold_1G00005200 Rroxscaffold_2G00093470
rosa_rugosa	Rorug05G0449700
rosa_samantha	Rh2AG516200 Rh2BG527100 Rh2CG501100 Rh2DG536100 Rh5AG504300 Rh5CG549900 Rh5DG538100
rosa_wichuraiana	Rw2G042450

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	350
AatII	GACGTC	1 cut(s)	623
AccB1I	GGYRCC	1 cut(s)	563
AciI	CCGC	1 cut(s)	595
AclWI	GGATC	1 cut(s)	77
AcsI	RAATTY	3 cut(s)	6, 260, 579
AcyI	GRCGYC	1 cut(s)	620
AfiI	CCNNNNNNNGG	1 cut(s)	208
AflIII	ACRYGT	1 cut(s)	349
AgsI	TTSAA	3 cut(s)	12, 545, 605
AjnI	CCWGG	2 cut(s)	201, 489
AjuI	GAANNNNNNNTTGG	4 cut(s)	570, 597, 602, 629
AluBI	AGCT	3 cut(s)	62, 437, 613
AluI	AGCT	3 cut(s)	62, 437, 613
AlwI	GGATC	1 cut(s)	77
AlwNI	CAGNNNCTG	1 cut(s)	630
AoxI	GGCC	2 cut(s)	212, 534
ApeKI	GCWGC	2 cut(s)	20, 460
ApoI	RAATTY	3 cut(s)	6, 260, 579
AspS9I	GGNCC	1 cut(s)	212
AsuHPI	GGTGA	4 cut(s)	217, 233, 298, 309
BaeI	ACNNNNGTAYC	2 cut(s)	221, 254
BanI	GGYRCC	1 cut(s)	563
BbvI	GCAGC	2 cut(s)	7, 472
BccI	CCATC	1 cut(s)	300
BciT130I	CCWGG	2 cut(s)	203, 491
BclI	TGATCA	1 cut(s)	373
BisI	GCNGC	3 cut(s)	21, 461, 595
BlsI	GCNGC	3 cut(s)	22, 462, 596
Bme1390I	CCNGG	2 cut(s)	203, 491
BmgT120I	GGNCC	1 cut(s)	212
BmiI	GGNNCC	2 cut(s)	213, 565
BmrFI	CCNGG	2 cut(s)	203, 491
BmsI	GCATC	2 cut(s)	154, 176
BpuEI	CTTGAG	2 cut(s)	168, 491
BsaHI	GRCGYC	1 cut(s)	620
BsaXI	ACNNNNNCTCC	2 cut(s)	117, 147
Bsc4I	CCNNNNNNNGG	1 cut(s)	208
Bse1I	ACTGG	1 cut(s)	567
Bse3DI	GCAATG	1 cut(s)	516
BseBI	CCWGG	2 cut(s)	203, 491
BseLI	CCNNNNNNNGG	1 cut(s)	208
BseMI	GCAATG	1 cut(s)	516
BseMII	CTCAG	1 cut(s)	491
BseNI	ACTGG	1 cut(s)	567
BseXI	GCAGC	2 cut(s)	7, 472
BshFI	GGCC	2 cut(s)	214, 536
BshNI	GGYRCC	1 cut(s)	563
BsiSI	CCGG	1 cut(s)	517
BslI	CCNNNNNNNGG	1 cut(s)	208
BsmI	GAATGC	1 cut(s)	101
BsnI	GGCC	2 cut(s)	214, 536
Bsp143I	GATC	5 cut(s)	69, 81, 196, 373, 412
BspACI	CCGC	1 cut(s)	595
BspANI	GGCC	2 cut(s)	214, 536
BspCNI	CTCAG	1 cut(s)	490
BspHI	TCATGA	1 cut(s)	325
BspLI	GGNNCC	2 cut(s)	213, 565
BspPI	GGATC	1 cut(s)	77
BspT107I	GGYRCC	1 cut(s)	563
BsrDI	GCAATG	1 cut(s)	516
BsrI	ACTGG	1 cut(s)	567
BssMI	GATC	5 cut(s)	69, 81, 196, 373, 412
BssNI	GRCGYC	1 cut(s)	620
Bst2UI	CCWGG	2 cut(s)	203, 491
Bst4CI	ACNGT	2 cut(s)	133, 191
BstACI	GRCGYC	1 cut(s)	620
BstC8I	GCNNGC	1 cut(s)	381
BstDEI	CTNAG	1 cut(s)	477
BstENI	CCTNNNNNAGG	1 cut(s)	206
BstKTI	GATC	5 cut(s)	72, 84, 199, 376, 415
BstMBI	GATC	5 cut(s)	69, 81, 196, 373, 412
BstMWI	GCNNNNNNNGC	1 cut(s)	466
BstNI	CCWGG	2 cut(s)	203, 491
BstNSI	RCATGY	2 cut(s)	353, 383
BstSCI	CCNGG	2 cut(s)	201, 489
BstV1I	GCAGC	2 cut(s)	7, 472
BsuRI	GGCC	2 cut(s)	214, 536
BtsIMutI	CAGTG	1 cut(s)	574
Cac8I	GCNNGC	1 cut(s)	381
CaiI	CAGNNNCTG	1 cut(s)	630
CciI	TCATGA	1 cut(s)	325
Cfr13I	GGNCC	1 cut(s)	212
CseI	GACGC	1 cut(s)	515
CviAII	CATG	4 cut(s)	233, 326, 350, 380
DdeI	CTNAG	1 cut(s)	477
DpnI	GATC	5 cut(s)	71, 83, 198, 375, 414
DpnII	GATC	5 cut(s)	69, 81, 196, 373, 412
DrdI	GACNNNNNNGTC	1 cut(s)	350
DseDI	GACNNNNNNGTC	1 cut(s)	350
Eco147I	AGGCCT	1 cut(s)	536
EcoNI	CCTNNNNNAGG	1 cut(s)	206
EcoO109I	RGGNCCY	1 cut(s)	212
EcoRII	CCWGG	2 cut(s)	201, 489
EcoT22I	ATGCAT	1 cut(s)	169
FaeI	CATG	4 cut(s)	236, 329, 353, 383
FaiI	YATR	9 cut(s)	108, 120, 180, 234, 327, 351, 367, 372, 381
FatI	CATG	4 cut(s)	232, 325, 349, 379
FbaI	TGATCA	1 cut(s)	373
Fnu4HI	GCNGC	3 cut(s)	21, 461, 595
Fsp4HI	GCNGC	3 cut(s)	21, 461, 595
GluI	GCNGC	3 cut(s)	21, 461, 595
HaeIII	GGCC	2 cut(s)	214, 536
HapII	CCGG	1 cut(s)	517
HgaI	GACGC	1 cut(s)	515
Hin1I	GRCGYC	1 cut(s)	620
Hin1II	CATG	4 cut(s)	236, 329, 353, 383
HindIII	AAGCTT	1 cut(s)	611
HinfI	GANTC	4 cut(s)	288, 526, 545, 627
HpaII	CCGG	1 cut(s)	517
HphI	GGTGA	4 cut(s)	217, 233, 298, 309
Hpy166II	GTNNAC	2 cut(s)	136, 502
Hpy188I	TCNGA	4 cut(s)	74, 417, 480, 632
Hpy188III	TCNNGA	4 cut(s)	185, 242, 326, 624
Hpy8I	GTNNAC	2 cut(s)	136, 502
Hpy99I	CGWCG	1 cut(s)	509
HpyAV	CCTTC	4 cut(s)	116, 202, 225, 596
HpyCH4III	ACNGT	2 cut(s)	133, 191
HpyCH4IV	ACGT	1 cut(s)	620
HpyCH4V	TGCA	3 cut(s)	4, 167, 383
HpyF10VI	GCNNNNNNNGC	1 cut(s)	466
HpyF3I	CTNAG	1 cut(s)	477
HpySE526I	ACGT	1 cut(s)	620
Hsp92I	GRCGYC	1 cut(s)	620
Hsp92II	CATG	4 cut(s)	236, 329, 353, 383
Ksp22I	TGATCA	1 cut(s)	373
Kzo9I	GATC	5 cut(s)	69, 81, 196, 373, 412
LmnI	GCTCC	1 cut(s)	59
LpnPI	CCDG	8 cut(s)	188, 204, 215, 476, 503, 530, 537, 580
Lsp1109I	GCAGC	2 cut(s)	7, 472
LweI	GCATC	2 cut(s)	154, 176
MaeII	ACGT	1 cut(s)	620
MaeIII	GTNAC	3 cut(s)	25, 271, 315
MalI	GATC	5 cut(s)	71, 83, 198, 375, 414
MboI	GATC	5 cut(s)	69, 81, 196, 373, 412
MboII	GAAGA	1 cut(s)	581
MluCI	AATT	5 cut(s)	6, 13, 153, 260, 579
MnlI	CCTC	5 cut(s)	149, 424, 466, 513, 608
Mph1103I	ATGCAT	1 cut(s)	169
MseI	TTAA	2 cut(s)	156, 399
MspI	CCGG	1 cut(s)	517
MspR9I	CCNGG	2 cut(s)	203, 491
Mva1269I	GAATGC	1 cut(s)	101
MvaI	CCWGG	2 cut(s)	203, 491
MwoI	GCNNNNNNNGC	1 cut(s)	466
NdeII	GATC	5 cut(s)	69, 81, 196, 373, 412
NlaIII	CATG	4 cut(s)	236, 329, 353, 383
NlaIV	GGNNCC	2 cut(s)	213, 565
NmuCI	GTSAC	2 cut(s)	271, 315
NsiI	ATGCAT	1 cut(s)	169
NspI	RCATGY	2 cut(s)	353, 383
PaeI	GCATGC	1 cut(s)	383
PagI	TCATGA	1 cut(s)	325
PceI	AGGCCT	1 cut(s)	536
PciI	ACATGT	1 cut(s)	349
PctI	GAATGC	1 cut(s)	101
PfeI	GAWTC	3 cut(s)	288, 526, 545
PkrI	GCNGC	3 cut(s)	22, 462, 596
PscI	ACATGT	1 cut(s)	349
Psp6I	CCWGG	2 cut(s)	201, 489
PspGI	CCWGG	2 cut(s)	201, 489
PspN4I	GGNNCC	2 cut(s)	213, 565
PspPI	GGNCC	1 cut(s)	212
PstNI	CAGNNNCTG	1 cut(s)	630
SaqAI	TTAA	2 cut(s)	156, 399
SatI	GCNGC	3 cut(s)	21, 461, 595
Sau3AI	GATC	5 cut(s)	69, 81, 196, 373, 412
Sau96I	GGNCC	1 cut(s)	212
ScrFI	CCNGG	2 cut(s)	203, 491
SetI	ASST	8 cut(s)	64, 141, 162, 322, 439, 588, 615, 623
SfaNI	GCATC	2 cut(s)	154, 176
SmlI	CTYRAG	2 cut(s)	183, 470
SmoI	CTYRAG	2 cut(s)	183, 470
SphI	GCATGC	1 cut(s)	383
Sse9I	AATT	5 cut(s)	6, 13, 153, 260, 579
SseBI	AGGCCT	1 cut(s)	536
SsiI	CCGC	1 cut(s)	595
StuI	AGGCCT	1 cut(s)	536
StyD4I	CCNGG	2 cut(s)	201, 489
TaaI	ACNGT	2 cut(s)	133, 191
TaiI	ACGT	1 cut(s)	623
TaqI	TCGA	2 cut(s)	84, 264
TasI	AATT	5 cut(s)	6, 13, 153, 260, 579
TauI	GCSGC	1 cut(s)	597
TfiI	GAWTC	3 cut(s)	288, 526, 545
Tru1I	TTAA	2 cut(s)	156, 399
Tru9I	TTAA	2 cut(s)	156, 399
TscAI	CASTG	1 cut(s)	574
TseFI	GTSAC	2 cut(s)	271, 315
TseI	GCWGC	2 cut(s)	20, 460
Tsp45I	GTSAC	2 cut(s)	271, 315
TspDTI	ATGAA	3 cut(s)	108, 135, 342
TspGWI	ACGGA	1 cut(s)	622
TspRI	CASTG	1 cut(s)	574
XagI	CCTNNNNNAGG	1 cut(s)	206
XapI	RAATTY	3 cut(s)	6, 260, 579
XceI	RCATGY	2 cut(s)	353, 383
ZraI	GACGTC	1 cut(s)	621
Zsp2I	ATGCAT	1 cut(s)	169

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.