Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0017500.1

Orthogroup ID

OG0004137

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 1405

Gene Structure 1405 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0017500.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 703 bp

cagtcaaacccattatcaattacaccgtaccctttttgtttctctctccaattttgattgtttcacagagaagatggagctgctgggattgttaatgatgggttttgtggtcttgtgccaaatgaaaggctcggttgggttgaggttcgtgatagatagagaagagtgcttctctcatgaggcaaagtatgagggtgacactgttcatgtctcttttgttgtgatcaaaatcgattcgacttggcattacactcaagaaggagttgatcttgtggtaaaggggccttctggtgaacaacttcatgacatacgtgacaagacgagtgagaagtttgaatttgtggttcagaaggccggtgttcatcacttctgcttcactaacaagtctccttaccatgaaaccattgattttgatgtacattctgcgcacttcacatattatgatgagcatgctaaagatgagcatttcaaacccttgtttgagcagattcaaaagttggaggaagccattttcaatatccaatttgaacagcactggctagaggctgagactgaccgccaggcaatattgaatgaaggaatgagtcagagggcaactcacaaggcaatgtttgaatcagctgcacttattggaaccagcctcctccaagtttttcttttgaaacgtttgtttgagcgcaagcttgggtcatctagagtctag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

EMP24_GP25L

Protein Analysis

233

Amino Acids

27.11

Weight (kDa)

5.81

Isoelectric Point (pI)

34.37

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004137)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G07680
fragaria_vesca	FvH4_3g42910 FvH4_3g42910 FvH4_3g42910 FvH4_6g40540 FvH4_6g40540
malus_domestica	MD03G1028700.v1.1 MD09G1128600.v1.1 MD17G1118000.v1.1
prunus_persica	Prupe.3G196600_v2.0.a1 Prupe.3G196600_v2.0.a1 Prupe.6G024700_v2.0.a1 Prupe.6G024700_v2.0.a1
pyrus_communis	pycom09g05220 pycom17g10850
rosa_chinensis	RchiOBHm_Chr2g0155801 RchiOBHm_Chr5g0076951
rosa_laevigata	RLG00000020865 RLG00000036636
rosa_multiflora	Rmu_sc0003417.1_g000010 Rmu_sc0007021.1_g000016 Rmu_sc0017500.1_g000001
rosa_roxburghii	Rroxscaffold_1G00005200 Rroxscaffold_2G00093470
rosa_rugosa	Rorug05G0449700
rosa_samantha	Rh2AG516200 Rh2BG527100 Rh2CG501100 Rh2DG536100 Rh5AG504300 Rh5CG549900 Rh5DG538100
rosa_wichuraiana	Rw2G042450

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc16I	TGCGCA	1 cut(s)	427
AciI	CCGC	1 cut(s)	557
AclI	AACGTT	1 cut(s)	665
AcsI	RAATTY	1 cut(s)	336
AfaI	GTAC	2 cut(s)	29, 418
AgsI	TTSAA	8 cut(s)	336, 470, 492, 515, 528, 572, 615, 662
AjnI	CCWGG	1 cut(s)	559
AluBI	AGCT	3 cut(s)	80, 621, 683
AluI	AGCT	3 cut(s)	80, 621, 683
Alw26I	GTCTC	3 cut(s)	215, 391, 543
AoxI	GGCC	2 cut(s)	282, 352
ApeKI	GCWGC	2 cut(s)	80, 621
ApoI	RAATTY	1 cut(s)	336
Asp700I	GAANNNNTTC	1 cut(s)	298
AspLEI	GCGC	2 cut(s)	428, 679
AspS9I	GGNCC	1 cut(s)	282
AsuHPI	GGTGA	2 cut(s)	207, 303
BbvI	GCAGC	2 cut(s)	67, 608
BccI	CCATC	2 cut(s)	68, 92
BciT130I	CCWGG	1 cut(s)	561
BclI	TGATCA	1 cut(s)	223
BcoDI	GTCTC	3 cut(s)	215, 391, 543
BfaI	CTAG	3 cut(s)	540, 694, 701
BisI	GCNGC	2 cut(s)	81, 622
BlsI	GCNGC	2 cut(s)	82, 623
Bme1390I	CCNGG	1 cut(s)	561
BmgT120I	GGNCC	1 cut(s)	282
BmiI	GGNNCC	2 cut(s)	283, 635
BmrFI	CCNGG	1 cut(s)	561
BplI	GAGNNNNNCTC	4 cut(s)	156, 188, 581, 613
BpuEI	CTTGAG	1 cut(s)	238
Bsa29I	ATCGAT	1 cut(s)	232
BsaAI	YACGTR	1 cut(s)	312
BsaBI	GATNNNNATC	1 cut(s)	228
Bse118I	RCCGGY	1 cut(s)	354
Bse1I	ACTGG	1 cut(s)	540
Bse3DI	GCAATG	1 cut(s)	613
Bse8I	GATNNNNATC	1 cut(s)	228
BseBI	CCWGG	1 cut(s)	561
BseCI	ATCGAT	1 cut(s)	232
BseJI	GATNNNNATC	1 cut(s)	228
BseMI	GCAATG	1 cut(s)	613
BseMII	CTCAG	1 cut(s)	538
BseNI	ACTGG	1 cut(s)	540
BseRI	GAGGAG	1 cut(s)	633
BseXI	GCAGC	2 cut(s)	67, 608
BseYI	CCCAGC	1 cut(s)	83
BsgI	GTGCAG	1 cut(s)	607
BshFI	GGCC	2 cut(s)	284, 354
BshVI	ATCGAT	1 cut(s)	232
BsiSI	CCGG	1 cut(s)	355
BsmAI	GTCTC	3 cut(s)	215, 391, 543
BsnI	GGCC	2 cut(s)	284, 354
Bsp1407I	TGTACA	1 cut(s)	416
Bsp143I	GATC	2 cut(s)	223, 266
BspACI	CCGC	1 cut(s)	557
BspANI	GGCC	2 cut(s)	284, 354
BspCNI	CTCAG	1 cut(s)	539
BspDI	ATCGAT	1 cut(s)	232
BspHI	TCATGA	2 cut(s)	176, 302
BspLI	GGNNCC	2 cut(s)	283, 635
BsrDI	GCAATG	1 cut(s)	613
BsrFI	RCCGGY	1 cut(s)	354
BsrGI	TGTACA	1 cut(s)	416
BsrI	ACTGG	1 cut(s)	540
BssAI	RCCGGY	1 cut(s)	354
BssMI	GATC	2 cut(s)	223, 266
Bst2UI	CCWGG	1 cut(s)	561
Bst4CI	ACNGT	2 cut(s)	27, 203
Bst6I	CTCTTC	1 cut(s)	157
BstAUI	TGTACA	1 cut(s)	416
BstBAI	YACGTR	1 cut(s)	312
BstC8I	GCNNGC	2 cut(s)	451, 681
BstDEI	CTNAG	1 cut(s)	547
BstHHI	GCGC	2 cut(s)	428, 679
BstKTI	GATC	2 cut(s)	226, 269
BstMAI	GTCTC	3 cut(s)	215, 391, 543
BstMBI	GATC	2 cut(s)	223, 266
BstNI	CCWGG	1 cut(s)	561
BstNSI	RCATGY	1 cut(s)	453
BstSCI	CCNGG	1 cut(s)	559
BstV1I	GCAGC	2 cut(s)	67, 608
Bsu15I	ATCGAT	1 cut(s)	232
BsuRI	GGCC	2 cut(s)	284, 354
BsuTUI	ATCGAT	1 cut(s)	232
BtsIMutI	CAGTG	2 cut(s)	199, 533
Cac8I	GCNNGC	2 cut(s)	451, 681
CciI	TCATGA	2 cut(s)	176, 302
CfoI	GCGC	2 cut(s)	428, 679
Cfr10I	RCCGGY	1 cut(s)	354
Cfr13I	GGNCC	1 cut(s)	282
ClaI	ATCGAT	1 cut(s)	232
Csp6I	GTAC	2 cut(s)	28, 417
CviAII	CATG	5 cut(s)	177, 207, 303, 396, 450
CviQI	GTAC	2 cut(s)	28, 417
DdeI	CTNAG	1 cut(s)	547
DpnI	GATC	2 cut(s)	225, 268
DpnII	GATC	2 cut(s)	223, 266
Eam1104I	CTCTTC	1 cut(s)	157
EarI	CTCTTC	1 cut(s)	157
EcoO109I	RGGNCCY	1 cut(s)	282
EcoRII	CCWGG	1 cut(s)	559
FaeI	CATG	5 cut(s)	180, 210, 306, 399, 453
FaiI	YATR	9 cut(s)	178, 190, 208, 304, 309, 397, 437, 442, 451
FalI	AAGNNNNNCTT	2 cut(s)	640, 672
FatI	CATG	5 cut(s)	176, 206, 302, 395, 449
FbaI	TGATCA	1 cut(s)	223
Fnu4HI	GCNGC	2 cut(s)	81, 622
Fsp4HI	GCNGC	2 cut(s)	81, 622
FspBI	CTAG	3 cut(s)	540, 694, 701
FspI	TGCGCA	1 cut(s)	427
GlaI	GCGC	2 cut(s)	427, 678
GluI	GCNGC	2 cut(s)	81, 622
GsaI	CCCAGC	1 cut(s)	87
HaeIII	GGCC	2 cut(s)	284, 354
HapII	CCGG	1 cut(s)	355
HhaI	GCGC	2 cut(s)	428, 679
Hin1II	CATG	5 cut(s)	180, 210, 306, 399, 453
Hin6I	GCGC	2 cut(s)	426, 677
HinP1I	GCGC	2 cut(s)	426, 677
HindIII	AAGCTT	1 cut(s)	681
HinfI	GANTC	5 cut(s)	234, 488, 584, 615, 697
HpaII	CCGG	1 cut(s)	355
HphI	GGTGA	2 cut(s)	207, 303
Hpy166II	GTNNAC	1 cut(s)	294
Hpy188I	TCNGA	2 cut(s)	349, 589
Hpy188III	TCNNGA	5 cut(s)	149, 177, 255, 303, 694
Hpy8I	GTNNAC	1 cut(s)	294
HpyAV	CCTTC	4 cut(s)	252, 295, 344, 570
HpyCH4III	ACNGT	2 cut(s)	27, 203
HpyCH4IV	ACGT	2 cut(s)	311, 665
HpyCH4V	TGCA	1 cut(s)	624
HpyF3I	CTNAG	1 cut(s)	547
HpySE526I	ACGT	2 cut(s)	311, 665
Hsp92II	CATG	5 cut(s)	180, 210, 306, 399, 453
HspAI	GCGC	2 cut(s)	426, 677
Ksp22I	TGATCA	1 cut(s)	223
Kzo9I	GATC	2 cut(s)	223, 266
LmnI	GCTCC	1 cut(s)	77
LpnPI	CCDG	7 cut(s)	69, 274, 368, 521, 546, 573, 650
Lsp1109I	GCAGC	2 cut(s)	67, 608
MaeI	CTAG	3 cut(s)	540, 694, 701
MaeII	ACGT	2 cut(s)	311, 665
MaeIII	GTNAC	2 cut(s)	195, 312
MalI	GATC	2 cut(s)	225, 268
MboI	GATC	2 cut(s)	223, 266
MboII	GAAGA	2 cut(s)	83, 174
MluCI	AATT	4 cut(s)	18, 50, 336, 522
MlyI	GAGTC	1 cut(s)	593
MmeI	TCCRAC	1 cut(s)	478
MnlI	CCTC	8 cut(s)	136, 173, 185, 494, 536, 583, 651, 654
MroXI	GAANNNNTTC	1 cut(s)	298
MseI	TTAA	1 cut(s)	93
MspA1I	CMGCKG	1 cut(s)	621
MspI	CCGG	1 cut(s)	355
MspR9I	CCNGG	1 cut(s)	561
MvaI	CCWGG	1 cut(s)	561
NdeII	GATC	2 cut(s)	223, 266
NlaIII	CATG	5 cut(s)	180, 210, 306, 399, 453
NlaIV	GGNNCC	2 cut(s)	283, 635
NmuCI	GTSAC	2 cut(s)	195, 312
NsbI	TGCGCA	1 cut(s)	427
NspI	RCATGY	1 cut(s)	453
PaeI	GCATGC	1 cut(s)	453
PagI	TCATGA	2 cut(s)	176, 302
PdmI	GAANNNNTTC	1 cut(s)	298
PfeI	GAWTC	3 cut(s)	234, 488, 615
PkrI	GCNGC	2 cut(s)	82, 623
PleI	GAGTC	1 cut(s)	592
PpsI	GAGTC	1 cut(s)	592
Ppu21I	YACGTR	1 cut(s)	312
Psp1406I	AACGTT	1 cut(s)	665
Psp6I	CCWGG	1 cut(s)	559
PspFI	CCCAGC	1 cut(s)	83
PspGI	CCWGG	1 cut(s)	559
PspN4I	GGNNCC	2 cut(s)	283, 635
PspPI	GGNCC	1 cut(s)	282
PvuII	CAGCTG	1 cut(s)	621
RsaI	GTAC	2 cut(s)	29, 418
RsaNI	GTAC	2 cut(s)	28, 417
SaqAI	TTAA	1 cut(s)	93
SatI	GCNGC	2 cut(s)	81, 622
Sau3AI	GATC	2 cut(s)	223, 266
Sau96I	GGNCC	1 cut(s)	282
SchI	GAGTC	1 cut(s)	593
ScrFI	CCNGG	1 cut(s)	561
SetI	ASST	6 cut(s)	82, 147, 314, 623, 668, 685
SmlI	CTYRAG	1 cut(s)	253
SmoI	CTYRAG	1 cut(s)	253
SphI	GCATGC	1 cut(s)	453
Sse9I	AATT	4 cut(s)	18, 50, 336, 522
SsiI	CCGC	1 cut(s)	557
SspI	AATATT	1 cut(s)	568
SspMI	CTAG	3 cut(s)	540, 694, 701
StyD4I	CCNGG	1 cut(s)	559
TaaI	ACNGT	2 cut(s)	27, 203
TaiI	ACGT	2 cut(s)	314, 668
TaqI	TCGA	2 cut(s)	232, 237
TasI	AATT	4 cut(s)	18, 50, 336, 522
TatI	WGTACW	1 cut(s)	416
TfiI	GAWTC	3 cut(s)	234, 488, 615
Tru1I	TTAA	1 cut(s)	93
Tru9I	TTAA	1 cut(s)	93
TscAI	CASTG	2 cut(s)	206, 540
TseFI	GTSAC	2 cut(s)	195, 312
TseI	GCWGC	2 cut(s)	80, 621
Tsp45I	GTSAC	2 cut(s)	195, 312
TspDTI	ATGAA	6 cut(s)	138, 195, 291, 351, 412, 589
TspRI	CASTG	2 cut(s)	206, 540
XapI	RAATTY	1 cut(s)	336
XbaI	TCTAGA	1 cut(s)	693
XceI	RCATGY	1 cut(s)	453
XmnI	GAANNNNTTC	1 cut(s)	298
XspI	CTAG	3 cut(s)	540, 694, 701

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.