Rmu_sc0007029.1_g000032

Polygalacturonase-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0007029.1
OG0003318
Physical Location & Seq
Reverse (-)
146374 .. 147841
1468 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 825 bp
atgtttgacaacgttcgaaatctgttagttcagggtcctggaaccatcaatggcaacggtcaaatctggtggcaaaactcttgcaaaagaaaacaaaccaaggctgtgaccttctacaaatgcaataactttgtggtgaagaatctgaagttccaagacgcacagcaaatgcacgtcagtttcgaagagtgcgctaatgttcaagctttgtatctaacagtaactgcgccggagactagtcccaacactgacggtattcatgttgccaatacccagaacatcacaatctcgaacagcaatatcggaacaggtgatgattgcatttcaattgtaagtggatcccaaaatgtgcaagcctccagtattacctgtggacctggccatggaatcagtatcggtagcttggggaaaggagggtctgaagaccatgtttcgcaagtaacagtgaacggagctaagatttcaggaaccacgaatggaatcaggatcaaaacatggcaaggaggctcaggaatggcaagcaacattgcttttcaaaacatagaaatgaatgatgtgaccaaccccataatcatagaccaaaactactgtgacaccagtgacgaaggacaatgcaaacaacagagcaaggcagtgaaggtacaaaatgtgttgtaccaaaacatcagagggacaagcacttcaaaagatgccataacatttgattgcagcaagagcattccatgtcagggaattgtgctgcaaaatgttcaactcgacaaaggagcagaatgcagcaatgttaatctggcttacaaaggaaatgtctcccctcgatgtgcttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00040 ko01100 map00040 map01100
Pfam Domains
Protein Families
Glyco_hydro_28

Protein Analysis

274

Amino Acids

29.35

Weight (kDa)

7.48

Isoelectric Point (pI)

32.09

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Glyco_hydro_28 PF00295 2 - 262 4e-89 Glycosyl hydrolases family 28
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclI AACGTT 1 cut(s) 12
AclWI GGATC 3 cut(s) 333, 346, 494
AcoI YGGCCR 1 cut(s) 379
AcuI CTGAAG 2 cut(s) 167, 441
AfaI GTAC 2 cut(s) 642, 656
AfiI CCNNNNNNNGG 2 cut(s) 383, 728
AgsI TTSAA 5 cut(s) 203, 327, 536, 684, 752
AhlI ACTAGT 1 cut(s) 236
AjiI CACGTC 1 cut(s) 175
AjnI CCWGG 2 cut(s) 37, 376
AluBI AGCT 3 cut(s) 206, 402, 455
AluI AGCT 3 cut(s) 206, 402, 455
Alw26I GTCTC 2 cut(s) 227, 811
AlwI GGATC 3 cut(s) 333, 346, 494
AlwNI CAGNNNCTG 1 cut(s) 224
AoxI GGCC 1 cut(s) 379
ApeKI GCWGC 3 cut(s) 708, 739, 774
ArsI GACNNNNNNTTYG 2 cut(s) 789, 821
AspLEI GCGC 2 cut(s) 194, 229
AspS9I GGNCC 2 cut(s) 35, 374
AsuHPI GGTGA 2 cut(s) 148, 323
AsuII TTCGAA 2 cut(s) 16, 183
AvaII GGWCC 2 cut(s) 35, 374
BalI TGGCCA 1 cut(s) 381
BamHI GGATCC 1 cut(s) 338
BbsI GAAGAC 1 cut(s) 429
BbvI GCAGC 3 cut(s) 720, 726, 786
BccI CCATC 1 cut(s) 53
BciT130I CCWGG 2 cut(s) 39, 378
BcoDI GTCTC 2 cut(s) 227, 811
BcuI ACTAGT 1 cut(s) 236
BfaI CTAG 1 cut(s) 237
BisI GCNGC 3 cut(s) 709, 740, 775
BlsI GCNGC 3 cut(s) 710, 741, 776
Bme1390I CCNGG 2 cut(s) 39, 378
Bme18I GGWCC 2 cut(s) 35, 374
BmgBI CACGTC 1 cut(s) 175
BmgT120I GGNCC 2 cut(s) 35, 374
BmiI GGNNCC 4 cut(s) 36, 43, 340, 469
BmrFI CCNGG 2 cut(s) 39, 378
BmsI GCATC 1 cut(s) 679
BpiI GAAGAC 1 cut(s) 429
BpmI CTGGAG 1 cut(s) 343
Bpu10I CCTNAGC 1 cut(s) 508
Bpu14I TTCGAA 2 cut(s) 16, 183
BsaJI CCNNGG 2 cut(s) 99, 382
Bsc4I CCNNNNNNNGG 2 cut(s) 383, 728
Bse1I ACTGG 2 cut(s) 360, 597
Bse3DI GCAATG 2 cut(s) 525, 784
BseBI CCWGG 2 cut(s) 39, 378
BseDI CCNNGG 2 cut(s) 99, 382
BseLI CCNNNNNNNGG 2 cut(s) 383, 728
BseMI GCAATG 2 cut(s) 525, 784
BseMII CTCAG 1 cut(s) 522
BseNI ACTGG 2 cut(s) 360, 597
BseXI GCAGC 3 cut(s) 720, 726, 786
BshFI GGCC 1 cut(s) 381
BsiSI CCGG 1 cut(s) 230
BslFI GGGAC 2 cut(s) 225, 685
BslI CCNNNNNNNGG 2 cut(s) 383, 728
BsmAI GTCTC 2 cut(s) 227, 811
BsmFI GGGAC 2 cut(s) 225, 685
BsmI GAATGC 2 cut(s) 717, 776
BsnI GGCC 1 cut(s) 381
Bsp119I TTCGAA 2 cut(s) 16, 183
Bsp143I GATC 2 cut(s) 338, 486
Bsp19I CCATGG 1 cut(s) 382
BspANI GGCC 1 cut(s) 381
BspCNI CTCAG 1 cut(s) 521
BspLI GGNNCC 4 cut(s) 36, 43, 340, 469
BspPI GGATC 3 cut(s) 333, 346, 494
BspT104I TTCGAA 2 cut(s) 16, 183
BsrDI GCAATG 2 cut(s) 525, 784
BsrI ACTGG 2 cut(s) 360, 597
BssECI CCNNGG 2 cut(s) 99, 382
BssMI GATC 2 cut(s) 338, 486
BssT1I CCWWGG 2 cut(s) 99, 382
Bst2UI CCWGG 2 cut(s) 39, 378
Bst4CI ACNGT 5 cut(s) 59, 220, 254, 445, 590
Bst6I CTCTTC 1 cut(s) 180
BstBI TTCGAA 2 cut(s) 16, 183
BstC8I GCNNGC 2 cut(s) 354, 520
BstDEI CTNAG 2 cut(s) 456, 508
BstDSI CCRYGG 1 cut(s) 382
BstHHI GCGC 2 cut(s) 194, 229
BstKTI GATC 2 cut(s) 341, 489
BstMAI GTCTC 2 cut(s) 227, 811
BstMBI GATC 2 cut(s) 338, 486
BstMWI GCNNNNNNNGC 1 cut(s) 714
BstNI CCWGG 2 cut(s) 39, 378
BstSCI CCNGG 2 cut(s) 37, 376
BstV1I GCAGC 3 cut(s) 720, 726, 786
BstV2I GAAGAC 1 cut(s) 429
BstX2I RGATCY 1 cut(s) 338
BstYI RGATCY 1 cut(s) 338
BsuRI GGCC 1 cut(s) 381
BtgI CCRYGG 1 cut(s) 382
BtrI CACGTC 1 cut(s) 175
BtsI GCAGTG 1 cut(s) 639
BtsIMutI CAGTG 4 cut(s) 246, 450, 604, 639
Cac8I GCNNGC 2 cut(s) 354, 520
CaiI CAGNNNCTG 1 cut(s) 224
CfoI GCGC 2 cut(s) 194, 229
Cfr13I GGNCC 2 cut(s) 35, 374
CseI GACGC 1 cut(s) 167
Csp6I GTAC 2 cut(s) 641, 655
CspCI CAANNNNNGTGG 2 cut(s) 50, 85
CviAII CATG 5 cut(s) 260, 383, 428, 495, 723
CviJI RGCY 8 cut(s) 104, 206, 356, 381, 402, 455, 507, 791
CviKI_1 RGCY 8 cut(s) 104, 206, 356, 381, 402, 455, 507, 791
CviQI GTAC 2 cut(s) 641, 655
DdeI CTNAG 2 cut(s) 456, 508
DpnI GATC 2 cut(s) 340, 488
DpnII GATC 2 cut(s) 338, 486
EaeI YGGCCR 1 cut(s) 379
Eam1104I CTCTTC 1 cut(s) 180
EarI CTCTTC 1 cut(s) 180
Eco130I CCWWGG 2 cut(s) 99, 382
Eco47I GGWCC 2 cut(s) 35, 374
Eco57I CTGAAG 2 cut(s) 167, 441
EcoO109I RGGNCCY 1 cut(s) 35
EcoRII CCWGG 2 cut(s) 37, 376
EcoT14I CCWWGG 2 cut(s) 99, 382
ErhI CCWWGG 2 cut(s) 99, 382
FaeI CATG 5 cut(s) 263, 386, 431, 498, 726
FaiI YATR 9 cut(s) 261, 384, 429, 496, 542, 569, 575, 695, 724
FaqI GGGAC 2 cut(s) 225, 685
FatI CATG 5 cut(s) 259, 382, 427, 494, 722
Fnu4HI GCNGC 3 cut(s) 709, 740, 775
Fsp4HI GCNGC 3 cut(s) 709, 740, 775
FspBI CTAG 1 cut(s) 237
GlaI GCGC 2 cut(s) 193, 228
GluI GCNGC 3 cut(s) 709, 740, 775
GsuI CTGGAG 1 cut(s) 343
HaeIII GGCC 1 cut(s) 381
HapII CCGG 1 cut(s) 230
HgaI GACGC 1 cut(s) 167
HhaI GCGC 2 cut(s) 194, 229
Hin1II CATG 5 cut(s) 263, 386, 431, 498, 726
Hin6I GCGC 2 cut(s) 192, 227
HinP1I GCGC 2 cut(s) 192, 227
HindIII AAGCTT 1 cut(s) 204
HinfI GANTC 3 cut(s) 142, 387, 480
HpaII CCGG 1 cut(s) 230
HphI GGTGA 2 cut(s) 148, 323
Hpy166II GTNNAC 2 cut(s) 374, 448
Hpy188I TCNGA 4 cut(s) 147, 305, 421, 668
Hpy188III TCNNGA 4 cut(s) 289, 465, 484, 510
Hpy8I GTNNAC 2 cut(s) 374, 448
HpyAV CCTTC 3 cut(s) 121, 599, 631
HpyCH4III ACNGT 5 cut(s) 59, 220, 254, 445, 590
HpyCH4IV ACGT 2 cut(s) 12, 174
HpyCH4V TGCA 9 cut(s) 84, 123, 172, 321, 352, 615, 708, 742, 774
HpyF10VI GCNNNNNNNGC 1 cut(s) 714
HpyF3I CTNAG 2 cut(s) 456, 508
HpySE526I ACGT 2 cut(s) 12, 174
Hsp92II CATG 5 cut(s) 263, 386, 431, 498, 726
HspAI GCGC 2 cut(s) 192, 227
Kzo9I GATC 2 cut(s) 338, 486
LmnI GCTCC 2 cut(s) 452, 764
Lsp1109I GCAGC 3 cut(s) 720, 726, 786
LweI GCATC 1 cut(s) 679
MaeI CTAG 1 cut(s) 237
MaeII ACGT 2 cut(s) 12, 174
MaeIII GTNAC 6 cut(s) 106, 220, 439, 556, 590, 599
MalI GATC 2 cut(s) 340, 488
MboI GATC 2 cut(s) 338, 486
MboII GAAGA 3 cut(s) 151, 197, 434
MfeI CAATTG 1 cut(s) 327
MflI RGATCY 1 cut(s) 338
MlsI TGGCCA 1 cut(s) 381
MluCI AATT 2 cut(s) 327, 732
MluNI TGGCCA 1 cut(s) 381
MnlI CCTC 5 cut(s) 367, 407, 497, 662, 822
Mox20I TGGCCA 1 cut(s) 381
MscI TGGCCA 1 cut(s) 381
MseI TTAA 2 cut(s) 783, 823
MslI CAYNNNNRTG 1 cut(s) 545
Msp20I TGGCCA 1 cut(s) 381
MspI CCGG 1 cut(s) 230
MspR9I CCNGG 2 cut(s) 39, 378
MunI CAATTG 1 cut(s) 327
Mva1269I GAATGC 2 cut(s) 717, 776
MvaI CCWGG 2 cut(s) 39, 378
MwoI GCNNNNNNNGC 1 cut(s) 714
NcoI CCATGG 1 cut(s) 382
NdeII GATC 2 cut(s) 338, 486
NlaIII CATG 5 cut(s) 263, 386, 431, 498, 726
NlaIV GGNNCC 4 cut(s) 36, 43, 340, 469
NmuCI GTSAC 4 cut(s) 106, 556, 590, 599
NspV TTCGAA 2 cut(s) 16, 183
PcsI WCGNNNNNNNCGW 1 cut(s) 180
PctI GAATGC 2 cut(s) 717, 776
PfeI GAWTC 3 cut(s) 142, 387, 480
PfoI TCCNGGA 1 cut(s) 37
PkrI GCNGC 3 cut(s) 710, 741, 776
PpuMI RGGWCCY 1 cut(s) 35
Psp1406I AACGTT 1 cut(s) 12
Psp5II RGGWCCY 1 cut(s) 35
Psp6I CCWGG 2 cut(s) 37, 376
PspGI CCWGG 2 cut(s) 37, 376
PspN4I GGNNCC 4 cut(s) 36, 43, 340, 469
PspPI GGNCC 2 cut(s) 35, 374
PspPPI RGGWCCY 1 cut(s) 35
PstNI CAGNNNCTG 1 cut(s) 224
PsuI RGATCY 1 cut(s) 338
RsaI GTAC 2 cut(s) 642, 656
RsaNI GTAC 2 cut(s) 641, 655
RseI CAYNNNNRTG 1 cut(s) 545
SaqAI TTAA 2 cut(s) 783, 823
SatI GCNGC 3 cut(s) 709, 740, 775
Sau3AI GATC 2 cut(s) 338, 486
Sau96I GGNCC 2 cut(s) 35, 374
ScrFI CCNGG 2 cut(s) 39, 378
SfaNI GCATC 1 cut(s) 679
SfuI TTCGAA 2 cut(s) 16, 183
SinI GGWCC 2 cut(s) 35, 374
SmiMI CAYNNNNRTG 1 cut(s) 545
SpeI ACTAGT 1 cut(s) 236
Sse9I AATT 2 cut(s) 327, 732
SspMI CTAG 1 cut(s) 237
StyD4I CCNGG 2 cut(s) 37, 376
StyI CCWWGG 2 cut(s) 99, 382
TaaI ACNGT 5 cut(s) 59, 220, 254, 445, 590
TaiI ACGT 2 cut(s) 15, 177
TaqI TCGA 5 cut(s) 16, 183, 290, 756, 814
TasI AATT 2 cut(s) 327, 732
TfiI GAWTC 3 cut(s) 142, 387, 480
Tru1I TTAA 2 cut(s) 783, 823
Tru9I TTAA 2 cut(s) 783, 823
TscAI CASTG 4 cut(s) 253, 450, 604, 639
TseFI GTSAC 4 cut(s) 106, 556, 590, 599
TseI GCWGC 3 cut(s) 708, 739, 774
Tsp45I GTSAC 4 cut(s) 106, 556, 590, 599
TspDTI ATGAA 2 cut(s) 248, 563
TspGWI ACGGA 1 cut(s) 465
TspRI CASTG 4 cut(s) 253, 450, 604, 639
VpaK11BI GGWCC 2 cut(s) 35, 374
XspI CTAG 1 cut(s) 237
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.