Rmu_sc0007628.1_g000001

integrin-mediated signaling pathway

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0007628.1
Physical Location & Seq
Reverse (-)
736 .. 1098
363 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0007628.1_g000001.1.cds

Sequence Viewer

Length: 207 bp
atgaatacacccctacattgggcctgcctgaatggacatgtcgaggtggttaagaaattgatcttggcgggagctaatgtaggtgtactaaacagctatgagaagagcccaattgatgaagctttgagtgggcaaaagatggatgttattgatgccgttaatgaatcagtggcccaagtagagcttactggcatcagagtgtcctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

68

Amino Acids

7.27

Weight (kDa)

5.08

Isoelectric Point (pI)

21.09

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 68
AfaI GTAC 1 cut(s) 87
AfiI CCNNNNNNNGG 2 cut(s) 18, 19
AflIII ACRYGT 1 cut(s) 37
AjuI GAANNNNNNNTTGG 2 cut(s) 47, 79
AluBI AGCT 4 cut(s) 74, 96, 122, 184
AluI AGCT 4 cut(s) 74, 96, 122, 184
AoxI GGCC 2 cut(s) 21, 171
AspS9I GGNCC 2 cut(s) 21, 172
BanII GRGCYC 1 cut(s) 110
BccI CCATC 1 cut(s) 133
BceAI ACGGC 1 cut(s) 140
BfaI CTAG 1 cut(s) 205
BmgT120I GGNCC 2 cut(s) 21, 172
BmsI GCATC 2 cut(s) 142, 201
BsaXI ACNNNNNCTCC 2 cut(s) 63, 93
Bsc4I CCNNNNNNNGG 2 cut(s) 18, 19
Bse1I ACTGG 1 cut(s) 193
BseGI GGATG 1 cut(s) 148
BseLI CCNNNNNNNGG 2 cut(s) 18, 19
BseNI ACTGG 1 cut(s) 193
BshFI GGCC 2 cut(s) 23, 173
BslI CCNNNNNNNGG 2 cut(s) 18, 19
BsnI GGCC 2 cut(s) 23, 173
Bsp1286I GDGCHC 1 cut(s) 110
Bsp143I GATC 1 cut(s) 60
BspACI CCGC 1 cut(s) 68
BspANI GGCC 2 cut(s) 23, 173
BspQI GCTCTTC 1 cut(s) 98
BsrI ACTGG 1 cut(s) 193
BssMI GATC 1 cut(s) 60
Bst6I CTCTTC 1 cut(s) 98
BstC8I GCNNGC 1 cut(s) 25
BstF5I GGATG 1 cut(s) 148
BstKTI GATC 1 cut(s) 63
BstMBI GATC 1 cut(s) 60
BstNSI RCATGY 1 cut(s) 41
BsuRI GGCC 2 cut(s) 23, 173
BtsCI GGATG 1 cut(s) 148
BtsIMutI CAGTG 1 cut(s) 174
Cac8I GCNNGC 1 cut(s) 25
Cfr13I GGNCC 2 cut(s) 21, 172
Csp6I GTAC 1 cut(s) 86
CviAII CATG 1 cut(s) 38
CviJI RGCY 7 cut(s) 23, 74, 96, 108, 122, 173, 184
CviKI_1 RGCY 7 cut(s) 23, 74, 96, 108, 122, 173, 184
CviQI GTAC 1 cut(s) 86
DpnI GATC 1 cut(s) 62
DpnII GATC 1 cut(s) 60
Eam1104I CTCTTC 1 cut(s) 98
EarI CTCTTC 1 cut(s) 98
Eco24I GRGCYC 1 cut(s) 110
EcoT38I GRGCYC 1 cut(s) 110
FaeI CATG 1 cut(s) 41
FaiI YATR 2 cut(s) 39, 99
FalI AAGNNNNNCTT 2 cut(s) 168, 200
FatI CATG 1 cut(s) 37
FauI CCCGC 1 cut(s) 61
FokI GGATG 1 cut(s) 155
FriOI GRGCYC 1 cut(s) 110
FspBI CTAG 1 cut(s) 205
HaeIII GGCC 2 cut(s) 23, 173
Hin1II CATG 1 cut(s) 41
HindIII AAGCTT 1 cut(s) 120
HinfI GANTC 1 cut(s) 164
Hpy166II GTNNAC 1 cut(s) 86
Hpy188I TCNGA 1 cut(s) 197
Hpy8I GTNNAC 1 cut(s) 86
Hsp92II CATG 1 cut(s) 41
Kzo9I GATC 1 cut(s) 60
LguI GCTCTTC 1 cut(s) 98
LmnI GCTCC 1 cut(s) 71
LpnPI CCDG 3 cut(s) 37, 41, 174
LweI GCATC 2 cut(s) 142, 201
MaeI CTAG 1 cut(s) 205
MalI GATC 1 cut(s) 62
MboI GATC 1 cut(s) 60
MboII GAAGA 1 cut(s) 115
MfeI CAATTG 1 cut(s) 111
MhlI GDGCHC 1 cut(s) 110
MluCI AATT 2 cut(s) 56, 111
MnlI CCTC 1 cut(s) 37
MseI TTAA 2 cut(s) 51, 159
MslI CAYNNNNRTG 1 cut(s) 197
MunI CAATTG 1 cut(s) 111
NdeII GATC 1 cut(s) 60
NlaIII CATG 1 cut(s) 41
NspI RCATGY 1 cut(s) 41
PciI ACATGT 1 cut(s) 37
PciSI GCTCTTC 1 cut(s) 98
PfeI GAWTC 1 cut(s) 164
PscI ACATGT 1 cut(s) 37
PspPI GGNCC 2 cut(s) 21, 172
RsaI GTAC 1 cut(s) 87
RsaNI GTAC 1 cut(s) 86
RseI CAYNNNNRTG 1 cut(s) 197
SapI GCTCTTC 1 cut(s) 98
SaqAI TTAA 2 cut(s) 51, 159
Sau3AI GATC 1 cut(s) 60
Sau96I GGNCC 2 cut(s) 21, 172
SduI GDGCHC 1 cut(s) 110
SetI ASST 6 cut(s) 48, 76, 85, 98, 124, 186
SfaNI GCATC 2 cut(s) 142, 201
SgeI CNNG 8 cut(s) 36, 40, 50, 55, 76, 81, 188, 201
SmiMI CAYNNNNRTG 1 cut(s) 197
Sse9I AATT 2 cut(s) 56, 111
SsiI CCGC 1 cut(s) 68
SspMI CTAG 1 cut(s) 205
TaqI TCGA 1 cut(s) 42
TasI AATT 2 cut(s) 56, 111
TatI WGTACW 1 cut(s) 85
TfiI GAWTC 1 cut(s) 164
Tru1I TTAA 2 cut(s) 51, 159
Tru9I TTAA 2 cut(s) 51, 159
TscAI CASTG 1 cut(s) 174
TspDTI ATGAA 3 cut(s) 17, 132, 177
TspRI CASTG 1 cut(s) 174
XceI RCATGY 1 cut(s) 41
XspI CTAG 1 cut(s) 205
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.