Rmu_sc0007639.1_g000001

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0007639.1
OG0003259
Physical Location & Seq
Reverse (-)
1 .. 861
861 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0007639.1_g000001.1.cds

Sequence Viewer

Length: 416 bp
atgctcacttgtcctctgtccttacttgtggcctcgctggacattccaccgtcgtcatccccccttccctcctccgattctcaactttcacagtcgctggagctcttgggagttcgaaacaatcttgcggaattgggtaagagcttcaagacaggcccctcgtttctctccatcgccgaaatctccaaattggctttgaacttgatgccagttcggaacggagcttcggaagaagatggcggcggttccgtgccaagaattaccaatgaaattctcgacttcgtcgctcagattttgaagcttttgaactattggacccgctttcctataccactagaccaccatgaagttggaatggaagctgagcaaagggaacttatagcagaagaactggaaggaggtggccgacatcgtgg
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
BSD

Protein Analysis

139

Amino Acids

15.05

Weight (kDa)

4.88

Isoelectric Point (pI)

49.84

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 4 cut(s) 128, 240, 243, 319
AcoI YGGCCR 1 cut(s) 403
AcsI RAATTY 1 cut(s) 270
AgsI TTSAA 4 cut(s) 148, 199, 298, 307
AluBI AGCT 5 cut(s) 103, 144, 224, 301, 362
AluI AGCT 5 cut(s) 103, 144, 224, 301, 362
Alw21I GWGCWC 1 cut(s) 105
AlwNI CAGNNNCTG 1 cut(s) 97
AoxI GGCC 3 cut(s) 30, 154, 403
ApoI RAATTY 1 cut(s) 270
AspS9I GGNCC 2 cut(s) 155, 315
AsuII TTCGAA 1 cut(s) 115
AvaII GGWCC 1 cut(s) 315
BanII GRGCYC 1 cut(s) 105
Bbv12I GWGCWC 1 cut(s) 105
BccI CCATC 2 cut(s) 179, 230
BfaI CTAG 1 cut(s) 335
BisI GCNGC 1 cut(s) 241
BlpI GCTNAGC 1 cut(s) 363
BlsI GCNGC 1 cut(s) 242
Bme18I GGWCC 1 cut(s) 315
BmgT120I GGNCC 2 cut(s) 155, 315
BmiI GGNNCC 3 cut(s) 157, 247, 317
BmsI GCATC 1 cut(s) 195
BpmI CTGGAG 1 cut(s) 119
Bpu1102I GCTNAGC 1 cut(s) 363
Bpu14I TTCGAA 1 cut(s) 115
Bse1I ACTGG 2 cut(s) 209, 396
BseGI GGATG 1 cut(s) 56
BseMII CTCAG 2 cut(s) 302, 354
BseNI ACTGG 2 cut(s) 209, 396
BseRI GAGGAG 1 cut(s) 61
BshFI GGCC 3 cut(s) 32, 156, 405
BsiHKAI GWGCWC 1 cut(s) 105
BsnI GGCC 3 cut(s) 32, 156, 405
Bsp119I TTCGAA 1 cut(s) 115
Bsp1286I GDGCHC 1 cut(s) 105
Bsp1720I GCTNAGC 1 cut(s) 363
BspACI CCGC 4 cut(s) 128, 240, 243, 319
BspANI GGCC 3 cut(s) 32, 156, 405
BspCNI CTCAG 2 cut(s) 301, 355
BspLI GGNNCC 3 cut(s) 157, 247, 317
BspT104I TTCGAA 1 cut(s) 115
BsrI ACTGG 2 cut(s) 209, 396
Bst4CI ACNGT 2 cut(s) 51, 93
BstBI TTCGAA 1 cut(s) 115
BstDEI CTNAG 2 cut(s) 288, 363
BstF5I GGATG 1 cut(s) 56
BstXI CCANNNNNNTGG 1 cut(s) 350
BsuRI GGCC 3 cut(s) 32, 156, 405
BtgZI GCGATG 1 cut(s) 157
BtsCI GGATG 1 cut(s) 56
CaiI CAGNNNCTG 1 cut(s) 97
Cfr13I GGNCC 2 cut(s) 155, 315
CviAII CATG 1 cut(s) 344
CviJI RGCY 9 cut(s) 32, 103, 144, 156, 194, 224, 301, 362, 405
CviKI_1 RGCY 9 cut(s) 32, 103, 144, 156, 194, 224, 301, 362, 405
DdeI CTNAG 2 cut(s) 288, 363
EaeI YGGCCR 1 cut(s) 403
Ecl136II GAGCTC 1 cut(s) 103
Eco24I GRGCYC 1 cut(s) 105
Eco47I GGWCC 1 cut(s) 315
Eco53kI GAGCTC 1 cut(s) 103
EcoICRI GAGCTC 1 cut(s) 103
EcoO109I RGGNCCY 1 cut(s) 155
EcoT38I GRGCYC 1 cut(s) 105
FaeI CATG 1 cut(s) 347
FaiI YATR 3 cut(s) 329, 345, 380
FatI CATG 1 cut(s) 343
FauI CCCGC 1 cut(s) 326
Fnu4HI GCNGC 1 cut(s) 241
FokI GGATG 1 cut(s) 43
FriOI GRGCYC 1 cut(s) 105
Fsp4HI GCNGC 1 cut(s) 241
FspBI CTAG 1 cut(s) 335
GluI GCNGC 1 cut(s) 241
GsuI CTGGAG 1 cut(s) 119
HaeIII GGCC 3 cut(s) 32, 156, 405
Hin1II CATG 1 cut(s) 347
HindIII AAGCTT 1 cut(s) 299
HinfI GANTC 1 cut(s) 77
Hpy188I TCNGA 4 cut(s) 76, 216, 229, 291
Hpy188III TCNNGA 2 cut(s) 148, 275
Hpy99I CGWCG 2 cut(s) 55, 287
HpyAV CCTTC 2 cut(s) 74, 389
HpyCH4III ACNGT 2 cut(s) 51, 93
HpyF3I CTNAG 2 cut(s) 288, 363
Hsp92II CATG 1 cut(s) 347
LmnI GCTCC 2 cut(s) 100, 221
LpnPI CCDG 5 cut(s) 23, 83, 138, 222, 377
LweI GCATC 1 cut(s) 195
MaeI CTAG 1 cut(s) 335
MboII GAAGA 3 cut(s) 242, 245, 398
MhlI GDGCHC 1 cut(s) 105
MluCI AATT 4 cut(s) 131, 188, 258, 270
MmeI TCCRAC 1 cut(s) 331
MnlI CCTC 6 cut(s) 24, 43, 79, 82, 169, 392
NlaIII CATG 1 cut(s) 347
NlaIV GGNNCC 3 cut(s) 157, 247, 317
NspV TTCGAA 1 cut(s) 115
PfeI GAWTC 1 cut(s) 77
PflFI GACNNNGTC 1 cut(s) 281
PkrI GCNGC 1 cut(s) 242
Psp124BI GAGCTC 1 cut(s) 105
PspN4I GGNNCC 3 cut(s) 157, 247, 317
PspPI GGNCC 2 cut(s) 155, 315
PstNI CAGNNNCTG 1 cut(s) 97
PsyI GACNNNGTC 1 cut(s) 281
SacI GAGCTC 1 cut(s) 105
SatI GCNGC 1 cut(s) 241
Sau96I GGNCC 2 cut(s) 155, 315
SduI GDGCHC 1 cut(s) 105
SetI ASST 6 cut(s) 105, 146, 226, 303, 364, 403
SfaNI GCATC 1 cut(s) 195
SfuI TTCGAA 1 cut(s) 115
SinI GGWCC 1 cut(s) 315
Sse9I AATT 4 cut(s) 131, 188, 258, 270
SsiI CCGC 4 cut(s) 128, 240, 243, 319
SspMI CTAG 1 cut(s) 335
SstI GAGCTC 1 cut(s) 105
TaaI ACNGT 2 cut(s) 51, 93
TaqI TCGA 2 cut(s) 115, 276
TasI AATT 4 cut(s) 131, 188, 258, 270
TauI GCSGC 1 cut(s) 243
TfiI GAWTC 1 cut(s) 77
TspDTI ATGAA 2 cut(s) 282, 360
TspGWI ACGGA 2 cut(s) 234, 238
Tth111I GACNNNGTC 1 cut(s) 281
VpaK11BI GGWCC 1 cut(s) 315
XapI RAATTY 1 cut(s) 270
XcmI CCANNNNNNNNNTGG 1 cut(s) 347
XspI CTAG 1 cut(s) 335
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.