Basic Information

Type: gene

Biological Identity

Species

rosa_samantha

Chromosome

Chr2A

Orthogroup ID

OG0003259

Physical Location & Seq

Genomic Coordinates Forward (+)

2101195 .. 2101965

Gene Structure 771 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rh2AG030300.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 501 bp

ATGTCTTGGCTCTTCACCTCTCTCCAACCCGACGCGGAAAACGACGCGTCGTTTCTCGGCCAAACCCTCACCCGCCAACTCCGCGGCGTCGCCACCTTCCTCGCTCCGCCGCCCTCCTCCTCCAAGTCCCTTCCCTCCTCCGATTGTCCACCGCCGTCGCCGTCGCCGGCTCTCTTGGGAGTCCGAAACGATCTCGCGGAATTGGGCGGGAGCTTAAAGACCGGCCTCTCGCTTCTCTCCGTCGCCGGAATCTCCAAATTGGCTTCGAACTTGCTCCCGGTTGGGAACGGAGCTCCGGAAGACGACGGCGGCGGCGGTCCCGTGCCGGGGATTACCGATGAGATTGTCGGCTTCGTCGCTCAGATTTCGAAGCTTCCGGACTGTTGGACCGGCTTTCCTATACCACTGGACCACCATGATTTTAGCATGTCCAATGCTCAGAGAGTCAGAGAGAACATGCCTCCACTGTCGAACAATTGGTTCCGGGGTTTGCTGATCTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

BSD

Protein Analysis

166

Amino Acids

17.4

Weight (kDa)

4.8

Isoelectric Point (pI)

54.17

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003259)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G10950 AT2G10950 AT2G10950
fragaria_vesca	FvH4_1g02550
malus_domestica	MD02G1023000.v1.1 MD15G1165700.v1.1
prunus_persica	Prupe.7G249100_v2.0.a1 Prupe.7G249100_v2.0.a1 Prupe.7G249100_v2.0.a1 Prupe.7G249100_v2.0.a1 Prupe.7G249100_v2.0.a1
pyrus_communis	pycom02g01980 pycom02g01990 pycom15g14850
rosa_chinensis	RchiOBHm_Chr2g0087581
rosa_laevigata	RLG00000014236 RLG00000015880
rosa_multiflora	Rmu_sc0000129.1_g000013 Rmu_sc0000146.1_g000024 Rmu_sc0001000.1_g000015 Rmu_sc0002299.1_g000025 Rmu_sc0007639.1_g000001
rosa_roxburghii	Rroxscaffold_2G00153450 Rroxscaffold_6G00397290
rosa_rugosa	Rorug01G0476700
rosa_samantha	Rh2AG030300 Rh2AG030400 Rh2BG030100 Rh2CG030400 Rh2DG030300 Rh4CG011200 Rh4CG011800 Rh4CG012200 Rh4CG012600 Rh4DG394600 Rh5AG455300
rosa_wichuraiana	Rw2G002400

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccII	CGCG	4 cut(s)	35, 47, 84, 197
AccIII	TCCGGA	2 cut(s)	295, 376
AcoI	YGGCCR	1 cut(s)	58
AcyI	GRCGYC	1 cut(s)	87
AfiI	CCNNNNNNNGG	2 cut(s)	326, 327
AflIII	ACRYGT	1 cut(s)	45
AluBI	AGCT	3 cut(s)	213, 293, 373
AluI	AGCT	3 cut(s)	213, 293, 373
Alw21I	GWGCWC	1 cut(s)	295
Aor13HI	TCCGGA	2 cut(s)	295, 376
AoxI	GGCC	2 cut(s)	58, 223
AspS9I	GGNCC	3 cut(s)	317, 387, 409
AsuC2I	CCSGG	3 cut(s)	278, 327, 485
AsuHPI	GGTGA	2 cut(s)	7, 61
AsuII	TTCGAA	2 cut(s)	266, 368
AvaII	GGWCC	3 cut(s)	317, 387, 409
BanII	GRGCYC	1 cut(s)	295
BbsI	GAAGAC	1 cut(s)	306
Bbv12I	GWGCWC	1 cut(s)	295
BceAI	ACGGC	3 cut(s)	139, 145, 322
BcnI	CCSGG	3 cut(s)	278, 327, 485
BisI	GCNGC	4 cut(s)	85, 110, 310, 313
BlsI	GCNGC	4 cut(s)	86, 111, 311, 314
Bme1390I	CCNGG	3 cut(s)	278, 327, 485
Bme18I	GGWCC	3 cut(s)	317, 387, 409
BmgT120I	GGNCC	3 cut(s)	317, 387, 409
BmiI	GGNNCC	2 cut(s)	319, 482
BmrFI	CCNGG	3 cut(s)	278, 327, 485
BpiI	GAAGAC	1 cut(s)	306
Bpu14I	TTCGAA	2 cut(s)	266, 368
BpuMI	CCSGG	3 cut(s)	278, 327, 485
BsaHI	GRCGYC	1 cut(s)	87
BsaJI	CCNNGG	3 cut(s)	82, 326, 484
BsaWI	WCCGGW	2 cut(s)	295, 376
Bsc4I	CCNNNNNNNGG	2 cut(s)	326, 327
Bse118I	RCCGGY	3 cut(s)	166, 221, 389
Bse1I	ACTGG	1 cut(s)	411
BseAI	TCCGGA	2 cut(s)	295, 376
BseDI	CCNNGG	3 cut(s)	82, 326, 484
BseLI	CCNNNNNNNGG	2 cut(s)	326, 327
BseMII	CTCAG	2 cut(s)	374, 452
BseNI	ACTGG	1 cut(s)	411
BseRI	GAGGAG	3 cut(s)	106, 109, 127
Bsh1236I	CGCG	4 cut(s)	35, 47, 84, 197
BshFI	GGCC	2 cut(s)	60, 225
BsiHKAI	GWGCWC	1 cut(s)	295
BsiSI	CCGG	9 cut(s)	167, 222, 246, 278, 296, 326, 377, 390, 484
BslFI	GGGAC	2 cut(s)	112, 303
BslI	CCNNNNNNNGG	2 cut(s)	326, 327
BsmFI	GGGAC	2 cut(s)	112, 303
BsnI	GGCC	2 cut(s)	60, 225
Bsp119I	TTCGAA	2 cut(s)	266, 368
Bsp1286I	GDGCHC	1 cut(s)	295
Bsp13I	TCCGGA	2 cut(s)	295, 376
Bsp143I	GATC	2 cut(s)	190, 495
BspANI	GGCC	2 cut(s)	60, 225
BspCNI	CTCAG	2 cut(s)	373, 451
BspEI	TCCGGA	2 cut(s)	295, 376
BspFNI	CGCG	4 cut(s)	35, 47, 84, 197
BspLI	GGNNCC	2 cut(s)	319, 482
BspQI	GCTCTTC	1 cut(s)	17
BspT104I	TTCGAA	2 cut(s)	266, 368
BsrFI	RCCGGY	3 cut(s)	166, 221, 389
BsrI	ACTGG	1 cut(s)	411
BssAI	RCCGGY	3 cut(s)	166, 221, 389
BssECI	CCNNGG	3 cut(s)	82, 326, 484
BssMI	GATC	2 cut(s)	190, 495
BssNI	GRCGYC	1 cut(s)	87
Bst4CI	ACNGT	2 cut(s)	383, 468
Bst6I	CTCTTC	1 cut(s)	17
BstACI	GRCGYC	1 cut(s)	87
BstBI	TTCGAA	2 cut(s)	266, 368
BstC8I	GCNNGC	1 cut(s)	168
BstDEI	CTNAG	2 cut(s)	360, 438
BstDSI	CCRYGG	1 cut(s)	82
BstFNI	CGCG	4 cut(s)	35, 47, 84, 197
BstKTI	GATC	2 cut(s)	193, 498
BstMBI	GATC	2 cut(s)	190, 495
BstMWI	GCNNNNNNNGC	1 cut(s)	81
BstNSI	RCATGY	2 cut(s)	430, 460
BstSCI	CCNGG	3 cut(s)	276, 325, 483
BstUI	CGCG	4 cut(s)	35, 47, 84, 197
BstV2I	GAAGAC	1 cut(s)	306
BsuRI	GGCC	2 cut(s)	60, 225
BtgI	CCRYGG	1 cut(s)	82
BtsIMutI	CAGTG	2 cut(s)	404, 464
Cac8I	GCNNGC	1 cut(s)	168
Cfr10I	RCCGGY	3 cut(s)	166, 221, 389
Cfr13I	GGNCC	3 cut(s)	317, 387, 409
Cfr42I	CCGCGG	1 cut(s)	85
CseI	GACGC	4 cut(s)	36, 41, 53, 76
CviAII	CATG	3 cut(s)	416, 427, 457
DdeI	CTNAG	2 cut(s)	360, 438
DpnI	GATC	2 cut(s)	192, 497
DpnII	GATC	2 cut(s)	190, 495
EaeI	YGGCCR	1 cut(s)	58
Eam1104I	CTCTTC	1 cut(s)	17
EarI	CTCTTC	1 cut(s)	17
EciI	GGCGGA	1 cut(s)	96
Ecl136II	GAGCTC	1 cut(s)	293
Eco24I	GRGCYC	1 cut(s)	295
Eco47I	GGWCC	3 cut(s)	317, 387, 409
Eco53kI	GAGCTC	1 cut(s)	293
EcoICRI	GAGCTC	1 cut(s)	293
EcoT38I	GRGCYC	1 cut(s)	295
FaeI	CATG	3 cut(s)	419, 430, 460
FaiI	YATR	4 cut(s)	401, 417, 428, 458
FaqI	GGGAC	2 cut(s)	112, 303
FatI	CATG	3 cut(s)	415, 426, 456
FauI	CCCGC	2 cut(s)	80, 200
Fnu4HI	GCNGC	4 cut(s)	85, 110, 310, 313
FriOI	GRGCYC	1 cut(s)	295
Fsp4HI	GCNGC	4 cut(s)	85, 110, 310, 313
GluI	GCNGC	4 cut(s)	85, 110, 310, 313
HaeIII	GGCC	2 cut(s)	60, 225
HapII	CCGG	9 cut(s)	167, 222, 246, 278, 296, 326, 377, 390, 484
HgaI	GACGC	4 cut(s)	36, 41, 53, 76
Hin1I	GRCGYC	1 cut(s)	87
Hin1II	CATG	3 cut(s)	419, 430, 460
HindIII	AAGCTT	1 cut(s)	371
HinfI	GANTC	3 cut(s)	180, 249, 444
HpaII	CCGG	9 cut(s)	167, 222, 246, 278, 296, 326, 377, 390, 484
HphI	GGTGA	2 cut(s)	7, 61
Hpy166II	GTNNAC	1 cut(s)	149
Hpy188I	TCNGA	5 cut(s)	142, 185, 363, 441, 449
Hpy188III	TCNNGA	2 cut(s)	296, 377
Hpy8I	GTNNAC	1 cut(s)	149
Hpy99I	CGWCG	9 cut(s)	35, 47, 52, 92, 160, 166, 245, 308, 359
HpyAV	CCTTC	2 cut(s)	106, 140
HpyCH4III	ACNGT	2 cut(s)	383, 468
HpyF10VI	GCNNNNNNNGC	1 cut(s)	81
HpyF3I	CTNAG	2 cut(s)	360, 438
Hsp92I	GRCGYC	1 cut(s)	87
Hsp92II	CATG	3 cut(s)	419, 430, 460
Kpn2I	TCCGGA	2 cut(s)	295, 376
KroI	GCCGGC	1 cut(s)	166
KroNI	GCCGGC	1 cut(s)	168
KspI	CCGCGG	1 cut(s)	85
Kzo9I	GATC	2 cut(s)	190, 495
LguI	GCTCTTC	1 cut(s)	17
LmnI	GCTCC	5 cut(s)	109, 210, 279, 290, 298
MalI	GATC	2 cut(s)	192, 497
MboI	GATC	2 cut(s)	190, 495
MboII	GAAGA	2 cut(s)	4, 311
MfeI	CAATTG	1 cut(s)	475
MhlI	GDGCHC	1 cut(s)	295
MluCI	AATT	3 cut(s)	200, 257, 475
MluI	ACGCGT	1 cut(s)	45
MlyI	GAGTC	2 cut(s)	189, 453
MmeI	TCCRAC	2 cut(s)	49, 365
MroI	TCCGGA	2 cut(s)	295, 376
MroNI	GCCGGC	1 cut(s)	166
MseI	TTAA	1 cut(s)	215
MspA1I	CMGCKG	1 cut(s)	84
MspI	CCGG	9 cut(s)	167, 222, 246, 278, 296, 326, 377, 390, 484
MspR9I	CCNGG	3 cut(s)	278, 327, 485
MunI	CAATTG	1 cut(s)	475
MvnI	CGCG	4 cut(s)	35, 47, 84, 197
MwoI	GCNNNNNNNGC	1 cut(s)	81
NaeI	GCCGGC	1 cut(s)	168
NciI	CCSGG	3 cut(s)	278, 327, 485
NdeII	GATC	2 cut(s)	190, 495
NgoMIV	GCCGGC	1 cut(s)	166
NlaIII	CATG	3 cut(s)	419, 430, 460
NlaIV	GGNNCC	2 cut(s)	319, 482
NmeAIII	GCCGAG	1 cut(s)	36
NspI	RCATGY	2 cut(s)	430, 460
NspV	TTCGAA	2 cut(s)	266, 368
PciSI	GCTCTTC	1 cut(s)	17
PcsI	WCGNNNNNNNCGW	1 cut(s)	39
PdiI	GCCGGC	1 cut(s)	168
PfeI	GAWTC	1 cut(s)	249
PkrI	GCNGC	4 cut(s)	86, 111, 311, 314
PleI	GAGTC	2 cut(s)	188, 452
PpsI	GAGTC	2 cut(s)	188, 452
Psp124BI	GAGCTC	1 cut(s)	295
PspN4I	GGNNCC	2 cut(s)	319, 482
PspPI	GGNCC	3 cut(s)	317, 387, 409
SacI	GAGCTC	1 cut(s)	295
SacII	CCGCGG	1 cut(s)	85
SapI	GCTCTTC	1 cut(s)	17
SaqAI	TTAA	1 cut(s)	215
SatI	GCNGC	4 cut(s)	85, 110, 310, 313
Sau3AI	GATC	2 cut(s)	190, 495
Sau96I	GGNCC	3 cut(s)	317, 387, 409
SchI	GAGTC	2 cut(s)	189, 453
ScrFI	CCNGG	3 cut(s)	278, 327, 485
SduI	GDGCHC	1 cut(s)	295
SetI	ASST	5 cut(s)	20, 98, 215, 295, 375
Sfr303I	CCGCGG	1 cut(s)	85
SfuI	TTCGAA	2 cut(s)	266, 368
SgrBI	CCGCGG	1 cut(s)	85
SinI	GGWCC	3 cut(s)	317, 387, 409
Sse9I	AATT	3 cut(s)	200, 257, 475
SstI	GAGCTC	1 cut(s)	295
StyD4I	CCNGG	3 cut(s)	276, 325, 483
TaaI	ACNGT	2 cut(s)	383, 468
TaqI	TCGA	3 cut(s)	266, 368, 470
TasI	AATT	3 cut(s)	200, 257, 475
TauI	GCSGC	4 cut(s)	87, 112, 312, 315
TfiI	GAWTC	1 cut(s)	249
Tru1I	TTAA	1 cut(s)	215
Tru9I	TTAA	1 cut(s)	215
TscAI	CASTG	2 cut(s)	411, 471
TspGWI	ACGGA	2 cut(s)	229, 303
TspRI	CASTG	2 cut(s)	411, 471
VpaK11BI	GGWCC	3 cut(s)	317, 387, 409
XceI	RCATGY	2 cut(s)	430, 460

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.