Rh4CG011800

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4C
Physical Location & Seq
Reverse (-)
2007465 .. 2007885
421 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4CG011800.1

Sequence Viewer

Length: 216 bp
ATGCCAGTTCGAACGGAGCTTTCGGAAGAAGACGGCGGCGGTTCCGTGCCAAGAATTACCAATGAAATTCTCGGCTTCGTCGCTCAGATTTTGAAGCTTTCGAACAATTGGACCCGCTTTCCTATACCACTGGACCACCATGAAGTCGGAATGGAAGCTGAGCAGAGGGAACCTATAGCAGAAGAACTGGAAGGAGGTGGTCGACATCGTGGGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

71

Amino Acids

7.9

Weight (kDa)

4.89

Isoelectric Point (pI)

52.79

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 202
AciI CCGC 3 cut(s) 36, 39, 115
AcsI RAATTY 1 cut(s) 66
AgsI TTSAA 1 cut(s) 94
AluBI AGCT 3 cut(s) 19, 97, 158
AluI AGCT 3 cut(s) 19, 97, 158
ApoI RAATTY 1 cut(s) 66
AspS9I GGNCC 2 cut(s) 111, 133
AsuII TTCGAA 2 cut(s) 10, 101
AvaII GGWCC 2 cut(s) 111, 133
BbsI GAAGAC 1 cut(s) 36
BceAI ACGGC 1 cut(s) 49
BfmI CTRYAG 1 cut(s) 174
BisI GCNGC 1 cut(s) 37
BlpI GCTNAGC 1 cut(s) 159
BlsI GCNGC 1 cut(s) 38
Bme18I GGWCC 2 cut(s) 111, 133
BmgT120I GGNCC 2 cut(s) 111, 133
BmiI GGNNCC 3 cut(s) 43, 113, 171
BpiI GAAGAC 1 cut(s) 36
Bpu1102I GCTNAGC 1 cut(s) 159
Bpu14I TTCGAA 2 cut(s) 10, 101
Bse1I ACTGG 3 cut(s) 5, 135, 192
BseMII CTCAG 2 cut(s) 98, 150
BseNI ACTGG 3 cut(s) 5, 135, 192
Bsp119I TTCGAA 2 cut(s) 10, 101
Bsp1720I GCTNAGC 1 cut(s) 159
BspACI CCGC 3 cut(s) 36, 39, 115
BspCNI CTCAG 2 cut(s) 97, 151
BspLI GGNNCC 3 cut(s) 43, 113, 171
BspT104I TTCGAA 2 cut(s) 10, 101
BsrI ACTGG 3 cut(s) 5, 135, 192
BstBI TTCGAA 2 cut(s) 10, 101
BstDEI CTNAG 2 cut(s) 84, 159
BstSFI CTRYAG 1 cut(s) 174
BstV2I GAAGAC 1 cut(s) 36
BtsIMutI CAGTG 1 cut(s) 128
Cfr13I GGNCC 2 cut(s) 111, 133
CviAII CATG 1 cut(s) 140
CviJI RGCY 4 cut(s) 19, 75, 97, 158
CviKI_1 RGCY 4 cut(s) 19, 75, 97, 158
DdeI CTNAG 2 cut(s) 84, 159
Eco47I GGWCC 2 cut(s) 111, 133
FaeI CATG 1 cut(s) 143
FaiI YATR 3 cut(s) 125, 141, 176
FatI CATG 1 cut(s) 139
FauI CCCGC 1 cut(s) 122
FblI GTMKAC 1 cut(s) 202
Fnu4HI GCNGC 1 cut(s) 37
Fsp4HI GCNGC 1 cut(s) 37
GluI GCNGC 1 cut(s) 37
Hin1II CATG 1 cut(s) 143
HincII GTYRAC 1 cut(s) 203
HindII GTYRAC 1 cut(s) 203
HindIII AAGCTT 1 cut(s) 95
Hpy166II GTNNAC 1 cut(s) 203
Hpy188I TCNGA 3 cut(s) 25, 87, 149
Hpy8I GTNNAC 1 cut(s) 203
Hpy99I CGWCG 1 cut(s) 83
HpyAV CCTTC 1 cut(s) 185
HpyF3I CTNAG 2 cut(s) 84, 159
Hsp92II CATG 1 cut(s) 143
LmnI GCTCC 1 cut(s) 16
LpnPI CCDG 3 cut(s) 18, 116, 173
MboII GAAGA 3 cut(s) 38, 41, 194
MfeI CAATTG 1 cut(s) 106
MluCI AATT 3 cut(s) 54, 66, 106
MmeI TCCRAC 1 cut(s) 127
MnlI CCTC 2 cut(s) 159, 188
MunI CAATTG 1 cut(s) 106
NlaIII CATG 1 cut(s) 143
NlaIV GGNNCC 3 cut(s) 43, 113, 171
NmeAIII GCCGAG 1 cut(s) 51
NspV TTCGAA 2 cut(s) 10, 101
PkrI GCNGC 1 cut(s) 38
PspN4I GGNNCC 3 cut(s) 43, 113, 171
PspPI GGNCC 2 cut(s) 111, 133
SalI GTCGAC 1 cut(s) 201
SatI GCNGC 1 cut(s) 37
Sau96I GGNCC 2 cut(s) 111, 133
SetI ASST 5 cut(s) 21, 99, 160, 175, 199
SfcI CTRYAG 1 cut(s) 174
SfuI TTCGAA 2 cut(s) 10, 101
SgeI CNNG 8 cut(s) 17, 58, 63, 83, 126, 143, 152, 200
SinI GGWCC 2 cut(s) 111, 133
Sse9I AATT 3 cut(s) 54, 66, 106
SsiI CCGC 3 cut(s) 36, 39, 115
TaqI TCGA 3 cut(s) 10, 101, 202
TasI AATT 3 cut(s) 54, 66, 106
TauI GCSGC 1 cut(s) 39
TscAI CASTG 1 cut(s) 135
TspDTI ATGAA 2 cut(s) 78, 156
TspGWI ACGGA 2 cut(s) 29, 34
TspRI CASTG 1 cut(s) 135
VpaK11BI GGWCC 2 cut(s) 111, 133
XapI RAATTY 1 cut(s) 66
XmiI GTMKAC 1 cut(s) 202
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.