Rmu_sc0008747.1_g000002

Peptidase M50B-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0008747.1
OG0001267
Physical Location & Seq
Reverse (-)
2396 .. 4609
2214 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0008747.1_g000002.1.cds

Sequence Viewer

Length: 702 bp
atggagccgaattggggactgaagaattgctgtaaccatgaccaagtggtgtttctcattactgtttctgtctgcactgttgttatacttgcgctttggaggacaatactgctgagaccgtttaagcttgtcactgtctttcttcatgaggctagccatgctatcgcttgtaaactaacatgtggtcatgtggaaggaatgcaagttcatgcagatgaaggtggagcaacacaaactcgtggtggtgtatactggttaattctgccagctggatatctaggttcatccttttgggggatgctcttgattcttgcatctacaaatcttcttacagcacggatagccgctggatgttttctagctgctctatttattacactctttatagctaaaaattggacacttcgaggactttgtataggattcattctgttccttggtgtaatttgggctctgcaagaaacaacaaaagttcgtgtacttcggtatattattctgtttataggtgtgatgaacagcttattttcagtatatgatatctatgatgatttgatatcccgtagagttcattctagtgatgctgagaagtttgcagtagagtgtccttgctgtactggttgtggatggggtgtcatatggggcttaatatctttcttgcttctctgtggagccatgtaccttggtcttgtgattttggcttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Peptidase_M50B

Protein Analysis

233

Amino Acids

25.71

Weight (kDa)

7.98

Isoelectric Point (pI)

30.32

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 249
AciI CCGC 1 cut(s) 345
AcuI CTGAAG 1 cut(s) 41
AfaI GTAC 3 cut(s) 480, 613, 677
AfiI CCNNNNNNNGG 2 cut(s) 14, 294
AflIII ACRYGT 1 cut(s) 179
AjuI GAANNNNNNNTTGG 2 cut(s) 36, 68
AloI GAACNNNNNNTCC 2 cut(s) 189, 221
AluBI AGCT 5 cut(s) 127, 269, 362, 389, 519
AluI AGCT 5 cut(s) 127, 269, 362, 389, 519
Alw26I GTCTC 1 cut(s) 109
ApeKI GCWGC 1 cut(s) 362
AspLEI GCGC 1 cut(s) 94
AsuNHI GCTAGC 1 cut(s) 152
BanII GRGCYC 1 cut(s) 454
BauI CACGAG 1 cut(s) 237
BbvI GCAGC 1 cut(s) 349
BccI CCATC 1 cut(s) 618
BcoDI GTCTC 1 cut(s) 109
BfaI CTAG 4 cut(s) 153, 278, 359, 573
BisI GCNGC 2 cut(s) 345, 363
BlsI GCNGC 2 cut(s) 346, 364
BmiI GGNNCC 2 cut(s) 6, 670
BmsI GCATC 3 cut(s) 288, 323, 568
BmtI GCTAGC 1 cut(s) 156
BsaI GGTCTC 1 cut(s) 109
BsaJI CCNNGG 2 cut(s) 436, 679
Bsc4I CCNNNNNNNGG 2 cut(s) 14, 294
Bse1I ACTGG 2 cut(s) 257, 619
BseDI CCNNGG 2 cut(s) 436, 679
BseGI GGATG 4 cut(s) 284, 303, 356, 629
BseLI CCNNNNNNNGG 2 cut(s) 14, 294
BseMII CTCAG 2 cut(s) 104, 573
BseNI ACTGG 2 cut(s) 257, 619
BseXI GCAGC 1 cut(s) 349
BsgI GTGCAG 1 cut(s) 58
BslFI GGGAC 1 cut(s) 30
BslI CCNNNNNNNGG 2 cut(s) 14, 294
BsmAI GTCTC 1 cut(s) 109
BsmFI GGGAC 1 cut(s) 30
BsmI GAATGC 1 cut(s) 204
Bso31I GGTCTC 1 cut(s) 109
Bsp1286I GDGCHC 1 cut(s) 454
BspACI CCGC 1 cut(s) 345
BspCNI CTCAG 2 cut(s) 105, 574
BspHI TCATGA 1 cut(s) 145
BspLI GGNNCC 2 cut(s) 6, 670
BspOI GCTAGC 1 cut(s) 156
BspTNI GGTCTC 1 cut(s) 109
BsrI ACTGG 2 cut(s) 257, 619
BssECI CCNNGG 2 cut(s) 436, 679
BssNAI GTATAC 1 cut(s) 250
BssSI CACGAG 1 cut(s) 237
BssT1I CCWWGG 2 cut(s) 436, 679
Bst1107I GTATAC 1 cut(s) 250
Bst2BI CACGAG 1 cut(s) 237
Bst4CI ACNGT 4 cut(s) 64, 79, 120, 136
BstC8I GCNNGC 2 cut(s) 154, 267
BstDEI CTNAG 2 cut(s) 113, 582
BstF5I GGATG 4 cut(s) 284, 303, 356, 629
BstHHI GCGC 1 cut(s) 94
BstMAI GTCTC 1 cut(s) 109
BstMWI GCNNNNNNNGC 2 cut(s) 158, 341
BstNSI RCATGY 1 cut(s) 183
BstV1I GCAGC 1 cut(s) 349
BstZ17I GTATAC 1 cut(s) 250
BtsCI GGATG 4 cut(s) 284, 303, 356, 629
BtsIMutI CAGTG 2 cut(s) 75, 132
Cac8I GCNNGC 2 cut(s) 154, 267
CciI TCATGA 1 cut(s) 145
CfoI GCGC 1 cut(s) 94
Csp6I GTAC 3 cut(s) 479, 612, 676
CviAII CATG 7 cut(s) 38, 146, 158, 180, 188, 209, 673
CviQI GTAC 3 cut(s) 479, 612, 676
DdeI CTNAG 2 cut(s) 113, 582
Eco130I CCWWGG 2 cut(s) 436, 679
Eco24I GRGCYC 1 cut(s) 454
Eco31I GGTCTC 1 cut(s) 109
Eco32I GATATC 3 cut(s) 275, 538, 555
Eco57I CTGAAG 1 cut(s) 41
EcoRV GATATC 3 cut(s) 275, 538, 555
EcoT14I CCWWGG 2 cut(s) 436, 679
EcoT38I GRGCYC 1 cut(s) 454
ErhI CCWWGG 2 cut(s) 436, 679
FaeI CATG 7 cut(s) 41, 149, 161, 183, 191, 212, 676
FaqI GGGAC 1 cut(s) 30
FatI CATG 7 cut(s) 37, 145, 157, 179, 187, 208, 672
FauNDI CATATG 1 cut(s) 635
FblI GTMKAC 1 cut(s) 249
Fnu4HI GCNGC 2 cut(s) 345, 363
FokI GGATG 4 cut(s) 271, 310, 363, 636
FriOI GRGCYC 1 cut(s) 454
Fsp4HI GCNGC 2 cut(s) 345, 363
FspBI CTAG 4 cut(s) 153, 278, 359, 573
GlaI GCGC 1 cut(s) 93
GluI GCNGC 2 cut(s) 345, 363
HhaI GCGC 1 cut(s) 94
Hin1II CATG 7 cut(s) 41, 149, 161, 183, 191, 212, 676
Hin6I GCGC 1 cut(s) 92
HinP1I GCGC 1 cut(s) 92
HindIII AAGCTT 1 cut(s) 125
HinfI GANTC 2 cut(s) 307, 423
Hpy166II GTNNAC 3 cut(s) 173, 250, 479
Hpy188III TCNNGA 2 cut(s) 146, 304
Hpy8I GTNNAC 3 cut(s) 173, 250, 479
HpyAV CCTTC 2 cut(s) 188, 212
HpyCH4III ACNGT 4 cut(s) 64, 79, 120, 136
HpyCH4V TGCA 6 cut(s) 75, 202, 212, 314, 457, 593
HpyF10VI GCNNNNNNNGC 2 cut(s) 158, 341
HpyF3I CTNAG 2 cut(s) 113, 582
Hsp92II CATG 7 cut(s) 41, 149, 161, 183, 191, 212, 676
HspAI GCGC 1 cut(s) 92
LmnI GCTCC 3 cut(s) 4, 224, 668
LpnPI CCDG 5 cut(s) 238, 255, 279, 333, 600
Lsp1109I GCAGC 1 cut(s) 349
LweI GCATC 3 cut(s) 288, 323, 568
MaeI CTAG 4 cut(s) 153, 278, 359, 573
MaeIII GTNAC 2 cut(s) 32, 130
MboII GAAGA 3 cut(s) 34, 134, 317
MhlI GDGCHC 1 cut(s) 454
MluCI AATT 5 cut(s) 10, 25, 258, 394, 444
MnlI CCTC 3 cut(s) 93, 142, 401
MseI TTAA 3 cut(s) 123, 257, 644
MslI CAYNNNNRTG 2 cut(s) 213, 573
MspA1I CMGCKG 2 cut(s) 269, 347
Mva1269I GAATGC 1 cut(s) 204
MwoI GCNNNNNNNGC 2 cut(s) 158, 341
NdeI CATATG 1 cut(s) 635
NheI GCTAGC 1 cut(s) 152
NlaIII CATG 7 cut(s) 41, 149, 161, 183, 191, 212, 676
NlaIV GGNNCC 2 cut(s) 6, 670
NmuCI GTSAC 1 cut(s) 130
NspI RCATGY 1 cut(s) 183
PagI TCATGA 1 cut(s) 145
PciI ACATGT 1 cut(s) 179
PctI GAATGC 1 cut(s) 204
PfeI GAWTC 2 cut(s) 307, 423
PkrI GCNGC 2 cut(s) 346, 364
PscI ACATGT 1 cut(s) 179
PspN4I GGNNCC 2 cut(s) 6, 670
PvuII CAGCTG 1 cut(s) 269
RsaI GTAC 3 cut(s) 480, 613, 677
RsaNI GTAC 3 cut(s) 479, 612, 676
RseI CAYNNNNRTG 2 cut(s) 213, 573
SaqAI TTAA 3 cut(s) 123, 257, 644
SatI GCNGC 2 cut(s) 345, 363
SduI GDGCHC 1 cut(s) 454
SetI ASST 9 cut(s) 129, 223, 271, 283, 364, 391, 508, 521, 681
SfaNI GCATC 3 cut(s) 288, 323, 568
SmiMI CAYNNNNRTG 2 cut(s) 213, 573
Sse9I AATT 5 cut(s) 10, 25, 258, 394, 444
SsiI CCGC 1 cut(s) 345
SspMI CTAG 4 cut(s) 153, 278, 359, 573
StyI CCWWGG 2 cut(s) 436, 679
TaaI ACNGT 4 cut(s) 64, 79, 120, 136
TaqI TCGA 1 cut(s) 406
TasI AATT 5 cut(s) 10, 25, 258, 394, 444
TatI WGTACW 2 cut(s) 478, 611
TauI GCSGC 1 cut(s) 347
TfiI GAWTC 2 cut(s) 307, 423
Tru1I TTAA 3 cut(s) 123, 257, 644
Tru9I TTAA 3 cut(s) 123, 257, 644
TscAI CASTG 2 cut(s) 82, 139
TseFI GTSAC 1 cut(s) 130
TseI GCWGC 1 cut(s) 362
Tsp45I GTSAC 1 cut(s) 130
TspDTI ATGAA 7 cut(s) 134, 197, 231, 273, 415, 527, 557
TspGWI ACGGA 1 cut(s) 352
TspRI CASTG 2 cut(s) 82, 139
XceI RCATGY 1 cut(s) 183
XmiI GTMKAC 1 cut(s) 249
XspI CTAG 4 cut(s) 153, 278, 359, 573
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.