Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0009114.1

Orthogroup ID

OG0002191

Physical Location & Seq

Genomic Coordinates Forward (+)

54494 .. 60113

Gene Structure 5620 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0009114.1_g000016.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1302 bp

atggaggccaatcacccaaagcctcatgcaatcatggtacctgttcctctccaaggccatgtcaaccccttcacccacttggccatgaaccttgcatcaaatggcatcaccatcacttttgtcaacactcgatacattcatcaccagataaccaaatccaaaaccaaaaacaacaccaaacaagagcaagatcaagatgacatctttgcggcggcgcgtgggtccggccttgacatacgctatagaacagtgagcgatgctttcccactgtccttcaatcggtttcagaacagtgaccaatttcttgagggtagtatccatgtcttccctgcccatgttgatgaacttgttggagatttagtacaatctgacccctcaatcaattgtttgattgctgacaccttctacacatggccggtgatgatagccaacaagtacaaccttatcaatatctccttctggactgaaccagctttagtcttaaacatttactaccacttggacctcctcataaaacatggtcattttggttgtcatgataattgtgaggacaccatagattacatacctgcagagtctctttcagccttgcaagacaagcaacctacatatgcaattggccccctcttccccagtgaacccaccaagaatgttgtggctactaatctgatgtccgagattgactgtacacaatggctcaaaaccaagcctcaaggttcagttttgtatgtttcatttggtagctattgtcaggttactaagaatgagtttgaggaaatagctcaggggcttttgcttagtaaagtgaatttcatttgggtactacgccctgacactataagctacgacgaagaaaggtatattgttccctttggattggaagaccagagcgatagagggttaatggtgccttggtgttctcaggttgaggtgctctcaaatccagcaataggagggttcttaactcattgcggatggaattccatactggaaagtatgtggtttggtgttccaatgctgtgttttcctattgaaactgaccaaatcactaataggaaactagtggttgatgattggaggattggtctcaatctttgtgacaggaagccaatcacaaggttggaggtagcacaaaaggtcaaccgtctgatgggtggaaatttgggtgatcgactattgcagaaggagaccaagaaggcaaagcagacattgggggaagctttggctgcagatgggtcatcagaacagagtttccaccgatttattagtgacgtaaaggctaaaattcaaacacgcatttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0005575 GO:0005622 GO:0005623 GO:0008194 GO:0016740 GO:0016757 GO:0016758 GO:0035251 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044464 GO:0046527 GO:0080043 GO:0080044

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

UDPGT

Protein Analysis

433

Amino Acids

48.94

Weight (kDa)

5.69

Isoelectric Point (pI)

37.68

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002191)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G36970
fragaria_vesca	FvH4_6g16230 FvH4_6g16230 FvH4_6g16250
malus_domestica	MD12G1114000.v1.1 MD12G1114100.v1.1 MD12G1114200.v1.1
prunus_persica	Prupe.6G233100_v2.0.a1 Prupe.6G233200_v2.0.a1 Prupe.6G233300_v2.0.a1 Prupe.6G233400_v2.0.a1 Prupe.6G233500_v2.0.a1 Prupe.6G233600_v2.0.a1 Prupe.6G233600_v2.0.a1
pyrus_communis	pycom12g11320 pycom12g11330 pycom12g11340
rosa_chinensis	RchiOBHm_Chr3g0470071 RchiOBHm_Chr3g0470101 RchiOBHm_Chr3g0470111
rosa_laevigata	RLG00000024296 RLG00000024298 RLG00000024299
rosa_multiflora	Rmu_sc0005600.1_g000011 Rmu_sc0005600.1_g000012 Rmu_sc0009114.1_g000016
rosa_roxburghii	Rroxscaffold_6G00411170 Rroxscaffold_6G00411180 Rroxscaffold_6G00411200
rosa_rugosa	Rorug03G0106700 Rorug03G0106700
rosa_samantha	Rh3AG155900 Rh3AG156200 Rh3BG180100 Rh3BG180200 Rh3CG170600 Rh3CG171000 Rh3DG195100
rosa_wichuraiana	Rw3G014680 Rw3G014690 Rw3G014700 Rw3G014760 Rw3G014770

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	577
Acc65I	GGTACC	1 cut(s)	37
AccB1I	GGYRCC	2 cut(s)	37, 907
AccII	CGCG	1 cut(s)	217
AciI	CCGC	3 cut(s)	209, 212, 972
AcoI	YGGCCR	2 cut(s)	81, 413
AcsI	RAATTY	4 cut(s)	808, 979, 1159, 1284
AfaI	GTAC	5 cut(s)	39, 363, 437, 688, 822
AfiI	CCNNNNNNNGG	4 cut(s)	53, 279, 950, 1150
AgsI	TTSAA	3 cut(s)	277, 1034, 1289
AhlI	ACTAGT	1 cut(s)	1060
AloI	GAACNNNNNNTCC	2 cut(s)	1236, 1268
AluBI	AGCT	5 cut(s)	473, 744, 782, 843, 1220
AluI	AGCT	5 cut(s)	473, 744, 782, 843, 1220
Alw21I	GWGCWC	1 cut(s)	936
Alw26I	GTCTC	3 cut(s)	582, 1091, 1181
AoxI	GGCC	6 cut(s)	6, 55, 81, 226, 413, 619
ApeKI	GCWGC	1 cut(s)	1226
ApoI	RAATTY	4 cut(s)	808, 979, 1159, 1284
Asp718I	GGTACC	1 cut(s)	37
AspLEI	GCGC	1 cut(s)	217
AspS9I	GGNCC	3 cut(s)	222, 502, 620
AsuHPI	GGTGA	6 cut(s)	5, 64, 100, 134, 430, 1178
AvaII	GGWCC	2 cut(s)	222, 502
BalI	TGGCCA	1 cut(s)	83
BanI	GGYRCC	2 cut(s)	37, 907
BbsI	GAAGAC	2 cut(s)	316, 888
Bbv12I	GWGCWC	1 cut(s)	936
BbvI	GCAGC	1 cut(s)	1213
BccI	CCATC	4 cut(s)	119, 969, 1144, 1226
BciVI	GTATCC	1 cut(s)	326
BcoDI	GTCTC	3 cut(s)	582, 1091, 1181
BcuI	ACTAGT	1 cut(s)	1060
BfaI	CTAG	1 cut(s)	1061
BfmI	CTRYAG	3 cut(s)	241, 570, 1227
BfuAI	ACCTGC	1 cut(s)	577
BfuI	GTATCC	1 cut(s)	326
BisI	GCNGC	3 cut(s)	210, 213, 1227
BlsI	GCNGC	3 cut(s)	211, 214, 1228
Bme18I	GGWCC	2 cut(s)	222, 502
BmgT120I	GGNCC	3 cut(s)	222, 502, 620
BmiI	GGNNCC	4 cut(s)	39, 223, 622, 909
BmrI	ACTGGG	1 cut(s)	627
BmsI	GCATC	3 cut(s)	104, 114, 247
BmuI	ACTGGG	1 cut(s)	627
BpiI	GAAGAC	2 cut(s)	316, 888
BplI	GAGNNNNNCTC	2 cut(s)	920, 952
Bpu10I	CCTNAGC	1 cut(s)	783
BpuEI	CTTGAG	2 cut(s)	326, 696
BsaI	GGTCTC	2 cut(s)	1091, 1181
BsaJI	CCNNGG	2 cut(s)	52, 911
BsaXI	ACNNNNNCTCC	4 cut(s)	345, 375, 1069, 1099
Bsc4I	CCNNNNNNNGG	4 cut(s)	53, 279, 950, 1150
Bse118I	RCCGGY	1 cut(s)	415
Bse1I	ACTGG	2 cut(s)	633, 993
Bse3DI	GCAATG	1 cut(s)	967
BseDI	CCNNGG	2 cut(s)	52, 911
BseGI	GGATG	1 cut(s)	980
BseLI	CCNNNNNNNGG	4 cut(s)	53, 279, 950, 1150
BseMI	GCAATG	1 cut(s)	967
BseMII	CTCAG	2 cut(s)	797, 935
BseNI	ACTGG	2 cut(s)	633, 993
BseRI	GAGGAG	1 cut(s)	497
BseXI	GCAGC	1 cut(s)	1213
Bsh1236I	CGCG	1 cut(s)	217
BshFI	GGCC	6 cut(s)	8, 57, 83, 228, 415, 621
BshNI	GGYRCC	2 cut(s)	37, 907
BsiHKAI	GWGCWC	1 cut(s)	936
BsiSI	CCGG	2 cut(s)	225, 416
BslI	CCNNNNNNNGG	4 cut(s)	53, 279, 950, 1150
BsmAI	GTCTC	3 cut(s)	582, 1091, 1181
BsnI	GGCC	6 cut(s)	8, 57, 83, 228, 415, 621
Bso31I	GGTCTC	2 cut(s)	1091, 1181
Bsp1286I	GDGCHC	1 cut(s)	936
Bsp1407I	TGTACA	1 cut(s)	686
Bsp143I	GATC	2 cut(s)	190, 1168
BspACI	CCGC	3 cut(s)	209, 212, 972
BspANI	GGCC	6 cut(s)	8, 57, 83, 228, 415, 621
BspCNI	CTCAG	2 cut(s)	796, 934
BspFNI	CGCG	1 cut(s)	217
BspHI	TCATGA	1 cut(s)	535
BspLI	GGNNCC	4 cut(s)	39, 223, 622, 909
BspMAI	CTGCAG	2 cut(s)	574, 1231
BspMI	ACCTGC	1 cut(s)	577
BspT107I	GGYRCC	2 cut(s)	37, 907
BspTNI	GGTCTC	2 cut(s)	1091, 1181
BsrDI	GCAATG	1 cut(s)	967
BsrFI	RCCGGY	1 cut(s)	415
BsrGI	TGTACA	1 cut(s)	686
BsrI	ACTGG	2 cut(s)	633, 993
BssAI	RCCGGY	1 cut(s)	415
BssECI	CCNNGG	2 cut(s)	52, 911
BssMI	GATC	2 cut(s)	190, 1168
BssT1I	CCWWGG	2 cut(s)	52, 911
Bst4CI	ACNGT	5 cut(s)	250, 270, 293, 686, 1145
Bst6I	CTCTTC	1 cut(s)	632
BstAUI	TGTACA	1 cut(s)	686
BstDEI	CTNAG	4 cut(s)	759, 783, 797, 921
BstENI	CCTNNNNNAGG	1 cut(s)	51
BstF5I	GGATG	1 cut(s)	980
BstFNI	CGCG	1 cut(s)	217
BstHHI	GCGC	1 cut(s)	217
BstKTI	GATC	2 cut(s)	193, 1171
BstMAI	GTCTC	3 cut(s)	582, 1091, 1181
BstMBI	GATC	2 cut(s)	190, 1168
BstMWI	GCNNNNNNNGC	2 cut(s)	598, 1226
BstSFI	CTRYAG	3 cut(s)	241, 570, 1227
BstUI	CGCG	1 cut(s)	217
BstV1I	GCAGC	1 cut(s)	1213
BstV2I	GAAGAC	2 cut(s)	316, 888
BsuI	GTATCC	1 cut(s)	326
BsuRI	GGCC	6 cut(s)	8, 57, 83, 228, 415, 621
BtgZI	GCGATG	1 cut(s)	270
BtsCI	GGATG	1 cut(s)	980
BtsIMutI	CAGTG	4 cut(s)	255, 266, 298, 640
BveI	ACCTGC	1 cut(s)	577
CciI	TCATGA	1 cut(s)	535
CfoI	GCGC	1 cut(s)	217
Cfr10I	RCCGGY	1 cut(s)	415
Cfr13I	GGNCC	3 cut(s)	222, 502, 620
Csp6I	GTAC	5 cut(s)	38, 362, 436, 687, 821
CviAII	CATG	9 cut(s)	26, 34, 59, 85, 320, 335, 411, 518, 536
CviQI	GTAC	5 cut(s)	38, 362, 436, 687, 821
DdeI	CTNAG	4 cut(s)	759, 783, 797, 921
DpnI	GATC	2 cut(s)	192, 1170
DpnII	GATC	2 cut(s)	190, 1168
EaeI	YGGCCR	2 cut(s)	81, 413
Eam1104I	CTCTTC	1 cut(s)	632
EarI	CTCTTC	1 cut(s)	632
Eco130I	CCWWGG	2 cut(s)	52, 911
Eco31I	GGTCTC	2 cut(s)	1091, 1181
Eco47I	GGWCC	2 cut(s)	222, 502
EcoNI	CCTNNNNNAGG	1 cut(s)	51
EcoRI	GAATTC	1 cut(s)	979
EcoT14I	CCWWGG	2 cut(s)	52, 911
ErhI	CCWWGG	2 cut(s)	52, 911
FaeI	CATG	9 cut(s)	29, 37, 62, 88, 323, 338, 414, 521, 539
FatI	CATG	9 cut(s)	25, 33, 58, 84, 319, 334, 410, 517, 535
FauNDI	CATATG	1 cut(s)	610
Fnu4HI	GCNGC	3 cut(s)	210, 213, 1227
FokI	GGATG	1 cut(s)	987
Fsp4HI	GCNGC	3 cut(s)	210, 213, 1227
FspBI	CTAG	1 cut(s)	1061
GlaI	GCGC	1 cut(s)	216
GluI	GCNGC	3 cut(s)	210, 213, 1227
HaeIII	GGCC	6 cut(s)	8, 57, 83, 228, 415, 621
HapII	CCGG	2 cut(s)	225, 416
HhaI	GCGC	1 cut(s)	217
Hin1II	CATG	9 cut(s)	29, 37, 62, 88, 323, 338, 414, 521, 539
Hin6I	GCGC	1 cut(s)	215
HinP1I	GCGC	1 cut(s)	215
HincII	GTYRAC	3 cut(s)	64, 124, 1141
HindII	GTYRAC	3 cut(s)	64, 124, 1141
HindIII	AAGCTT	1 cut(s)	1218
HinfI	GANTC	1 cut(s)	575
HpaII	CCGG	2 cut(s)	225, 416
HphI	GGTGA	6 cut(s)	5, 64, 100, 134, 430, 1178
Hpy166II	GTNNAC	5 cut(s)	64, 124, 638, 689, 1141
Hpy188I	TCNGA	6 cut(s)	288, 370, 669, 676, 1149, 1243
Hpy188III	TCNNGA	4 cut(s)	194, 305, 460, 536
Hpy8I	GTNNAC	5 cut(s)	64, 124, 638, 689, 1141
Hpy99I	CGWCG	1 cut(s)	851
HpyAV	CCTTC	6 cut(s)	79, 283, 412, 466, 1177, 1189
HpyCH4III	ACNGT	5 cut(s)	250, 270, 293, 686, 1145
HpyCH4IV	ACGT	1 cut(s)	1272
HpyCH4V	TGCA	7 cut(s)	29, 95, 572, 592, 614, 1180, 1229
HpyF10VI	GCNNNNNNNGC	2 cut(s)	598, 1226
HpyF3I	CTNAG	4 cut(s)	759, 783, 797, 921
HpySE526I	ACGT	1 cut(s)	1272
Hsp92II	CATG	9 cut(s)	29, 37, 62, 88, 323, 338, 414, 521, 539
HspAI	GCGC	1 cut(s)	215
KpnI	GGTACC	1 cut(s)	41
Kzo9I	GATC	2 cut(s)	190, 1168
Lsp1109I	GCAGC	1 cut(s)	1213
LweI	GCATC	3 cut(s)	104, 114, 247
MaeI	CTAG	1 cut(s)	1061
MaeII	ACGT	1 cut(s)	1272
MaeIII	GTNAC	4 cut(s)	293, 754, 1097, 1268
MalI	GATC	2 cut(s)	192, 1170
MboI	GATC	2 cut(s)	190, 1168
MboII	GAAGA	4 cut(s)	316, 619, 863, 893
MfeI	CAATTG	2 cut(s)	382, 615
MhlI	GDGCHC	1 cut(s)	936
MlsI	TGGCCA	1 cut(s)	83
MluCI	AATT	8 cut(s)	299, 382, 541, 615, 808, 979, 1159, 1284
MluNI	TGGCCA	1 cut(s)	83
MlyI	GAGTC	1 cut(s)	584
MmeI	TCCRAC	2 cut(s)	331, 1101
Mox20I	TGGCCA	1 cut(s)	83
MscI	TGGCCA	1 cut(s)	83
MseI	TTAA	3 cut(s)	482, 902, 962
MslI	CAYNNNNRTG	1 cut(s)	339
Msp20I	TGGCCA	1 cut(s)	83
MspI	CCGG	2 cut(s)	225, 416
MunI	CAATTG	2 cut(s)	382, 615
MvnI	CGCG	1 cut(s)	217
MwoI	GCNNNNNNNGC	2 cut(s)	598, 1226
NdeI	CATATG	1 cut(s)	610
NdeII	GATC	2 cut(s)	190, 1168
NlaIII	CATG	9 cut(s)	29, 37, 62, 88, 323, 338, 414, 521, 539
NlaIV	GGNNCC	4 cut(s)	39, 223, 622, 909
NmuCI	GTSAC	3 cut(s)	293, 1097, 1268
PagI	TCATGA	1 cut(s)	535
PkrI	GCNGC	3 cut(s)	211, 214, 1228
PleI	GAGTC	1 cut(s)	583
PpsI	GAGTC	1 cut(s)	583
PspN4I	GGNNCC	4 cut(s)	39, 223, 622, 909
PspPI	GGNCC	3 cut(s)	222, 502, 620
PstI	CTGCAG	2 cut(s)	574, 1231
RsaI	GTAC	5 cut(s)	39, 363, 437, 688, 822
RsaNI	GTAC	5 cut(s)	38, 362, 436, 687, 821
RseI	CAYNNNNRTG	1 cut(s)	339
SaqAI	TTAA	3 cut(s)	482, 902, 962
SatI	GCNGC	3 cut(s)	210, 213, 1227
Sau3AI	GATC	2 cut(s)	190, 1168
Sau96I	GGNCC	3 cut(s)	222, 502, 620
SchI	GAGTC	1 cut(s)	584
SduI	GDGCHC	1 cut(s)	936
SfaNI	GCATC	3 cut(s)	104, 114, 247
SfcI	CTRYAG	3 cut(s)	241, 570, 1227
SinI	GGWCC	2 cut(s)	222, 502
SmiMI	CAYNNNNRTG	1 cut(s)	339
SmlI	CTYRAG	2 cut(s)	305, 711
SmoI	CTYRAG	2 cut(s)	305, 711
SpeI	ACTAGT	1 cut(s)	1060
Sse9I	AATT	8 cut(s)	299, 382, 541, 615, 808, 979, 1159, 1284
SsiI	CCGC	3 cut(s)	209, 212, 972
SspMI	CTAG	1 cut(s)	1061
StyI	CCWWGG	2 cut(s)	52, 911
TaaI	ACNGT	5 cut(s)	250, 270, 293, 686, 1145
TaiI	ACGT	1 cut(s)	1275
TaqI	TCGA	2 cut(s)	130, 1171
TasI	AATT	8 cut(s)	299, 382, 541, 615, 808, 979, 1159, 1284
TatI	WGTACW	3 cut(s)	361, 435, 686
TauI	GCSGC	2 cut(s)	212, 215
Tru1I	TTAA	3 cut(s)	482, 902, 962
Tru9I	TTAA	3 cut(s)	482, 902, 962
TscAI	CASTG	4 cut(s)	255, 273, 298, 640
TseFI	GTSAC	3 cut(s)	293, 1097, 1268
TseI	GCWGC	1 cut(s)	1226
Tsp45I	GTSAC	3 cut(s)	293, 1097, 1268
TspDTI	ATGAA	5 cut(s)	101, 128, 357, 723, 802
TspRI	CASTG	4 cut(s)	255, 273, 298, 640
VpaK11BI	GGWCC	2 cut(s)	222, 502
XagI	CCTNNNNNAGG	1 cut(s)	51
XapI	RAATTY	4 cut(s)	808, 979, 1159, 1284
XcmI	CCANNNNNNNNNTGG	1 cut(s)	652
XspI	CTAG	1 cut(s)	1061

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.