Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0010924.1

Orthogroup ID

OG0002762

Physical Location & Seq

Genomic Coordinates Forward (+)

12746 .. 13416

Gene Structure 671 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0010924.1_g000005.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 375 bp

atgtctgcttacgataacgtggtgattgggaagctgaagctgaaaggcaaagccttgaacgtgaaaggtgggatcaaaaagaagaagacgaagcacagcaaacgctacgggtatgaccaatctcttcaagcctcaaaaggtggagatgcaatagatcgatttgagaatgatggtgatgaagacatagggaagggtggagtttttgatcagatgacaccggcggagaggcgatatctcgagcaggcagagaggcttcaagctcaaaggcttgcccaaatggccaagaaatcgcatcgtgatcgggttcaggaattcaatcagtatctggctaacctatctgagcattacgacatccccaaagtaggccctggttaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DUF1754

Protein Analysis

124

Amino Acids

13.97

Weight (kDa)

9.57

Isoelectric Point (pI)

34.93

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002762)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G16810 AT1G16810 AT1G16810
fragaria_vesca	FvH4_2g30690 FvH4_6g37010 FvH4_6g37010
malus_domestica	MD09G1165100.v1.1 MD15G1110000.v1.1
prunus_persica	Prupe.1G462200_v2.0.a1 Prupe.3G022600_v2.0.a1 Prupe.3G022600_v2.0.a1
pyrus_communis	pycom09g08240 pycom15g10010
rosa_chinensis	RchiOBHm_Chr2g0149551 RchiOBHm_Chr6g0312211
rosa_laevigata	RLG00000008248 RLG00000009118 RLG00000010342 RLG00000020419
rosa_multiflora	Rmu_sc0006867.1_g000014 Rmu_sc0010924.1_g000005 Rmu_sc0023979.1_g000001
rosa_roxburghii	Rroxscaffold_2G00098020 Rroxscaffold_3G00254310 Rroxscaffold_7G00156950 Rroxscaffold_7G00195390
rosa_rugosa	Rorug02G0412100 Rorug02G0412100 Rorug02G0412200 Rorug02G0412300
rosa_samantha	Rh2AG472700 Rh2BG484700 Rh2CG458600 Rh2DG493900 Rh6AG511000 Rh6BG522000 Rh6DG513200
rosa_wichuraiana	Rw2G038530 Rw6G044440

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	221
AclWI	GGATC	1 cut(s)	80
AcoI	YGGCCR	1 cut(s)	279
AcsI	RAATTY	1 cut(s)	311
AcuI	CTGAAG	1 cut(s)	56
AfiI	CCNNNNNNNGG	1 cut(s)	362
AgsI	TTSAA	4 cut(s)	58, 128, 257, 316
AjnI	CCWGG	1 cut(s)	367
AluBI	AGCT	3 cut(s)	34, 40, 260
AluI	AGCT	3 cut(s)	34, 40, 260
AlwI	GGATC	1 cut(s)	80
AlwNI	CAGNNNCTG	1 cut(s)	325
Ama87I	CYCGRG	1 cut(s)	236
AoxI	GGCC	2 cut(s)	279, 364
ApoI	RAATTY	1 cut(s)	311
AspS9I	GGNCC	1 cut(s)	365
AsuHPI	GGTGA	2 cut(s)	34, 185
AvaI	CYCGRG	1 cut(s)	236
BalI	TGGCCA	1 cut(s)	281
BbsI	GAAGAC	2 cut(s)	92, 186
BccI	CCATC	1 cut(s)	164
BcgI	CGANNNNNNTGC	2 cut(s)	281, 315
BciT130I	CCWGG	1 cut(s)	369
BclI	TGATCA	1 cut(s)	205
BglI	GCCNNNNNGGC	1 cut(s)	278
Bme1390I	CCNGG	1 cut(s)	369
BmeT110I	CYCGRG	1 cut(s)	236
BmgT120I	GGNCC	1 cut(s)	365
BmrFI	CCNGG	1 cut(s)	369
BmsI	GCATC	2 cut(s)	136, 301
BpiI	GAAGAC	2 cut(s)	92, 186
Bsa29I	ATCGAT	1 cut(s)	157
BsaJI	CCNNGG	1 cut(s)	367
Bsc4I	CCNNNNNNNGG	1 cut(s)	362
Bse118I	RCCGGY	1 cut(s)	217
BseBI	CCWGG	1 cut(s)	369
BseCI	ATCGAT	1 cut(s)	157
BseDI	CCNNGG	1 cut(s)	367
BseGI	GGATG	1 cut(s)	351
BseLI	CCNNNNNNNGG	1 cut(s)	362
BseMII	CTCAG	1 cut(s)	330
BshFI	GGCC	2 cut(s)	281, 366
BshVI	ATCGAT	1 cut(s)	157
BsiHKCI	CYCGRG	1 cut(s)	236
BsiSI	CCGG	1 cut(s)	218
BslI	CCNNNNNNNGG	1 cut(s)	362
BsnI	GGCC	2 cut(s)	281, 366
BsoBI	CYCGRG	1 cut(s)	236
Bsp143I	GATC	4 cut(s)	72, 154, 205, 298
BspACI	CCGC	1 cut(s)	221
BspANI	GGCC	2 cut(s)	281, 366
BspCNI	CTCAG	1 cut(s)	331
BspDI	ATCGAT	1 cut(s)	157
BspPI	GGATC	1 cut(s)	80
BsrFI	RCCGGY	1 cut(s)	217
BssAI	RCCGGY	1 cut(s)	217
BssECI	CCNNGG	1 cut(s)	367
BssMI	GATC	4 cut(s)	72, 154, 205, 298
Bst2UI	CCWGG	1 cut(s)	369
Bst6I	CTCTTC	1 cut(s)	129
BstC8I	GCNNGC	2 cut(s)	243, 270
BstDEI	CTNAG	1 cut(s)	339
BstF5I	GGATG	1 cut(s)	351
BstKTI	GATC	4 cut(s)	75, 157, 208, 301
BstMBI	GATC	4 cut(s)	72, 154, 205, 298
BstMWI	GCNNNNNNNGC	1 cut(s)	278
BstNI	CCWGG	1 cut(s)	369
BstSCI	CCNGG	1 cut(s)	367
BstV2I	GAAGAC	2 cut(s)	92, 186
Bsu15I	ATCGAT	1 cut(s)	157
BsuRI	GGCC	2 cut(s)	281, 366
BsuTUI	ATCGAT	1 cut(s)	157
BtsCI	GGATG	1 cut(s)	351
Cac8I	GCNNGC	2 cut(s)	243, 270
CaiI	CAGNNNCTG	1 cut(s)	325
Cfr10I	RCCGGY	1 cut(s)	217
Cfr13I	GGNCC	1 cut(s)	365
ClaI	ATCGAT	1 cut(s)	157
DdeI	CTNAG	1 cut(s)	339
DpnI	GATC	4 cut(s)	74, 156, 207, 300
DpnII	GATC	4 cut(s)	72, 154, 205, 298
EaeI	YGGCCR	1 cut(s)	279
Eam1104I	CTCTTC	1 cut(s)	129
EarI	CTCTTC	1 cut(s)	129
EciI	GGCGGA	1 cut(s)	236
Eco32I	GATATC	1 cut(s)	233
Eco57I	CTGAAG	1 cut(s)	56
Eco88I	CYCGRG	1 cut(s)	236
EcoO109I	RGGNCCY	1 cut(s)	365
EcoRI	GAATTC	1 cut(s)	311
EcoRII	CCWGG	1 cut(s)	367
EcoRV	GATATC	1 cut(s)	233
FaiI	YATR	2 cut(s)	114, 185
FbaI	TGATCA	1 cut(s)	205
FokI	GGATG	1 cut(s)	338
HaeIII	GGCC	2 cut(s)	281, 366
HapII	CCGG	1 cut(s)	218
HpaII	CCGG	1 cut(s)	218
HphI	GGTGA	2 cut(s)	34, 185
Hpy188I	TCNGA	2 cut(s)	210, 340
Hpy188III	TCNNGA	3 cut(s)	236, 296, 308
HpyAV	CCTTC	1 cut(s)	184
HpyCH4IV	ACGT	2 cut(s)	18, 60
HpyCH4V	TGCA	1 cut(s)	149
HpyF10VI	GCNNNNNNNGC	1 cut(s)	278
HpyF3I	CTNAG	1 cut(s)	339
HpySE526I	ACGT	2 cut(s)	18, 60
Ksp22I	TGATCA	1 cut(s)	205
Kzo9I	GATC	4 cut(s)	72, 154, 205, 298
LpnPI	CCDG	5 cut(s)	227, 231, 293, 311, 354
LweI	GCATC	2 cut(s)	136, 301
MaeII	ACGT	2 cut(s)	18, 60
MalI	GATC	4 cut(s)	74, 156, 207, 300
MboI	GATC	4 cut(s)	72, 154, 205, 298
MboII	GAAGA	4 cut(s)	94, 97, 116, 191
MlsI	TGGCCA	1 cut(s)	281
MluCI	AATT	1 cut(s)	311
MluNI	TGGCCA	1 cut(s)	281
MnlI	CCTC	3 cut(s)	142, 219, 243
Mox20I	TGGCCA	1 cut(s)	281
MscI	TGGCCA	1 cut(s)	281
MseI	TTAA	1 cut(s)	373
Msp20I	TGGCCA	1 cut(s)	281
MspI	CCGG	1 cut(s)	218
MspR9I	CCNGG	1 cut(s)	369
MvaI	CCWGG	1 cut(s)	369
MwoI	GCNNNNNNNGC	1 cut(s)	278
NdeII	GATC	4 cut(s)	72, 154, 205, 298
PaeR7I	CTCGAG	1 cut(s)	236
Psp6I	CCWGG	1 cut(s)	367
PspGI	CCWGG	1 cut(s)	367
PspPI	GGNCC	1 cut(s)	365
PstNI	CAGNNNCTG	1 cut(s)	325
SaqAI	TTAA	1 cut(s)	373
Sau3AI	GATC	4 cut(s)	72, 154, 205, 298
Sau96I	GGNCC	1 cut(s)	365
ScrFI	CCNGG	1 cut(s)	369
SetI	ASST	8 cut(s)	21, 36, 42, 63, 70, 142, 262, 336
SfaNI	GCATC	2 cut(s)	136, 301
Sfr274I	CTCGAG	1 cut(s)	236
SgrAI	CRCCGGYG	1 cut(s)	217
SlaI	CTCGAG	1 cut(s)	236
SmlI	CTYRAG	1 cut(s)	236
SmoI	CTYRAG	1 cut(s)	236
Sse9I	AATT	1 cut(s)	311
SsiI	CCGC	1 cut(s)	221
StyD4I	CCNGG	1 cut(s)	367
TaiI	ACGT	2 cut(s)	21, 63
TaqI	TCGA	2 cut(s)	157, 237
TasI	AATT	1 cut(s)	311
Tru1I	TTAA	1 cut(s)	373
Tru9I	TTAA	1 cut(s)	373
TspDTI	ATGAA	1 cut(s)	192
XapI	RAATTY	1 cut(s)	311
XhoI	CTCGAG	1 cut(s)	236

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.