Rmu_sc0023979.1_g000001

Eukaryotic family of unknown function (DUF1754)

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0023979.1
Physical Location & Seq
Forward (+)
567 .. 1242
676 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0023979.1_g000001.1.cds

Sequence Viewer

Length: 375 bp
atgtctgcttacgataacgtggtgattgggaagctgaggctgaaaggcaaagccttgaacgtgaaaggtgggatcaaaaagaagaagacgaagcacagcaaacgctacgggtatgaccaatctcttcaagcctcaataggtggagatgcaatagatcaatttgagaatgatggtgatgacgacatagggaaggctggagtttttgatcagatgacaccggcagagaggcgatatctcgagcaggcagagaggcttcaagctcaaaggcttgcccaaatggccaagaaatcgcatcgtgatcgggttcaggaattcaatcagtatctggctaacctatctgagcattacgacatccccaaagtaggccctggttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

124

Amino Acids

13.95

Weight (kDa)

9.4

Isoelectric Point (pI)

36.68

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 80
AcoI YGGCCR 1 cut(s) 279
AcsI RAATTY 1 cut(s) 311
AfiI CCNNNNNNNGG 1 cut(s) 362
AgsI TTSAA 4 cut(s) 58, 128, 257, 316
AjnI CCWGG 1 cut(s) 367
AluBI AGCT 2 cut(s) 34, 260
AluI AGCT 2 cut(s) 34, 260
AlwI GGATC 1 cut(s) 80
AlwNI CAGNNNCTG 1 cut(s) 325
Ama87I CYCGRG 1 cut(s) 236
AoxI GGCC 2 cut(s) 279, 364
ApoI RAATTY 1 cut(s) 311
AspS9I GGNCC 1 cut(s) 365
AsuHPI GGTGA 2 cut(s) 34, 185
AvaI CYCGRG 1 cut(s) 236
BalI TGGCCA 1 cut(s) 281
BbsI GAAGAC 1 cut(s) 92
BbvCI CCTCAGC 1 cut(s) 35
BccI CCATC 1 cut(s) 164
BcgI CGANNNNNNTGC 2 cut(s) 281, 315
BciT130I CCWGG 1 cut(s) 369
BclI TGATCA 1 cut(s) 205
BglI GCCNNNNNGGC 1 cut(s) 278
Bme1390I CCNGG 1 cut(s) 369
BmeT110I CYCGRG 1 cut(s) 236
BmgT120I GGNCC 1 cut(s) 365
BmrFI CCNGG 1 cut(s) 369
BmsI GCATC 2 cut(s) 136, 301
BpiI GAAGAC 1 cut(s) 92
BpmI CTGGAG 1 cut(s) 216
Bpu10I CCTNAGC 1 cut(s) 35
BsaJI CCNNGG 1 cut(s) 367
Bsc4I CCNNNNNNNGG 1 cut(s) 362
Bse118I RCCGGY 1 cut(s) 217
BseBI CCWGG 1 cut(s) 369
BseDI CCNNGG 1 cut(s) 367
BseGI GGATG 1 cut(s) 351
BseLI CCNNNNNNNGG 1 cut(s) 362
BseMII CTCAG 2 cut(s) 26, 330
BshFI GGCC 2 cut(s) 281, 366
BsiHKCI CYCGRG 1 cut(s) 236
BsiSI CCGG 1 cut(s) 218
BslI CCNNNNNNNGG 1 cut(s) 362
BsnI GGCC 2 cut(s) 281, 366
BsoBI CYCGRG 1 cut(s) 236
Bsp143I GATC 4 cut(s) 72, 154, 205, 298
BspANI GGCC 2 cut(s) 281, 366
BspCNI CTCAG 2 cut(s) 27, 331
BspPI GGATC 1 cut(s) 80
BsrFI RCCGGY 1 cut(s) 217
BssAI RCCGGY 1 cut(s) 217
BssECI CCNNGG 1 cut(s) 367
BssMI GATC 4 cut(s) 72, 154, 205, 298
Bst2UI CCWGG 1 cut(s) 369
Bst6I CTCTTC 1 cut(s) 129
BstC8I GCNNGC 2 cut(s) 243, 270
BstDEI CTNAG 2 cut(s) 35, 339
BstF5I GGATG 1 cut(s) 351
BstKTI GATC 4 cut(s) 75, 157, 208, 301
BstMBI GATC 4 cut(s) 72, 154, 205, 298
BstMWI GCNNNNNNNGC 1 cut(s) 278
BstNI CCWGG 1 cut(s) 369
BstSCI CCNGG 1 cut(s) 367
BstV2I GAAGAC 1 cut(s) 92
BsuRI GGCC 2 cut(s) 281, 366
BtsCI GGATG 1 cut(s) 351
Cac8I GCNNGC 2 cut(s) 243, 270
CaiI CAGNNNCTG 1 cut(s) 325
Cfr10I RCCGGY 1 cut(s) 217
Cfr13I GGNCC 1 cut(s) 365
DdeI CTNAG 2 cut(s) 35, 339
DpnI GATC 4 cut(s) 74, 156, 207, 300
DpnII GATC 4 cut(s) 72, 154, 205, 298
EaeI YGGCCR 1 cut(s) 279
Eam1104I CTCTTC 1 cut(s) 129
EarI CTCTTC 1 cut(s) 129
Eco32I GATATC 1 cut(s) 233
Eco88I CYCGRG 1 cut(s) 236
EcoO109I RGGNCCY 1 cut(s) 365
EcoRI GAATTC 1 cut(s) 311
EcoRII CCWGG 1 cut(s) 367
EcoRV GATATC 1 cut(s) 233
FaiI YATR 2 cut(s) 114, 185
FbaI TGATCA 1 cut(s) 205
FokI GGATG 1 cut(s) 338
GsuI CTGGAG 1 cut(s) 216
HaeIII GGCC 2 cut(s) 281, 366
HapII CCGG 1 cut(s) 218
HpaII CCGG 1 cut(s) 218
HphI GGTGA 2 cut(s) 34, 185
Hpy188I TCNGA 2 cut(s) 210, 340
Hpy188III TCNNGA 3 cut(s) 236, 296, 308
HpyAV CCTTC 1 cut(s) 184
HpyCH4IV ACGT 2 cut(s) 18, 60
HpyCH4V TGCA 1 cut(s) 149
HpyF10VI GCNNNNNNNGC 1 cut(s) 278
HpyF3I CTNAG 2 cut(s) 35, 339
HpySE526I ACGT 2 cut(s) 18, 60
Ksp22I TGATCA 1 cut(s) 205
Kzo9I GATC 4 cut(s) 72, 154, 205, 298
LpnPI CCDG 6 cut(s) 180, 227, 231, 293, 311, 354
LweI GCATC 2 cut(s) 136, 301
MaeII ACGT 2 cut(s) 18, 60
MalI GATC 4 cut(s) 74, 156, 207, 300
MboI GATC 4 cut(s) 72, 154, 205, 298
MboII GAAGA 3 cut(s) 94, 97, 116
MlsI TGGCCA 1 cut(s) 281
MluCI AATT 2 cut(s) 158, 311
MluNI TGGCCA 1 cut(s) 281
MnlI CCTC 4 cut(s) 30, 142, 219, 243
Mox20I TGGCCA 1 cut(s) 281
MscI TGGCCA 1 cut(s) 281
MseI TTAA 1 cut(s) 373
Msp20I TGGCCA 1 cut(s) 281
MspI CCGG 1 cut(s) 218
MspR9I CCNGG 1 cut(s) 369
MvaI CCWGG 1 cut(s) 369
MwoI GCNNNNNNNGC 1 cut(s) 278
NdeII GATC 4 cut(s) 72, 154, 205, 298
PaeR7I CTCGAG 1 cut(s) 236
Psp6I CCWGG 1 cut(s) 367
PspGI CCWGG 1 cut(s) 367
PspPI GGNCC 1 cut(s) 365
PstNI CAGNNNCTG 1 cut(s) 325
SaqAI TTAA 1 cut(s) 373
Sau3AI GATC 4 cut(s) 72, 154, 205, 298
Sau96I GGNCC 1 cut(s) 365
ScrFI CCNGG 1 cut(s) 369
SetI ASST 7 cut(s) 21, 36, 63, 70, 142, 262, 336
SfaNI GCATC 2 cut(s) 136, 301
Sfr274I CTCGAG 1 cut(s) 236
SlaI CTCGAG 1 cut(s) 236
SmlI CTYRAG 1 cut(s) 236
SmoI CTYRAG 1 cut(s) 236
Sse9I AATT 2 cut(s) 158, 311
StyD4I CCNGG 1 cut(s) 367
TaiI ACGT 2 cut(s) 21, 63
TaqI TCGA 1 cut(s) 237
TasI AATT 2 cut(s) 158, 311
Tru1I TTAA 1 cut(s) 373
Tru9I TTAA 1 cut(s) 373
XapI RAATTY 1 cut(s) 311
XhoI CTCGAG 1 cut(s) 236
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.