Rroxscaffold_7G00156950

Eukaryotic family of unknown function (DUF1754)

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000007
Physical Location & Seq
Forward (+)
826219 .. 826971
753 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_7G00156950.1

Sequence Viewer

Length: 342 bp
ATGTCTGCTTACGATAACGTGGTGATTGGGAAGCTGAAGCTGAAAGGCAAAGCCTTGAACGTGAAAGGTGGGATCAAAAAGAAGAAGACGAAGCACAGCAAACGCTACGAGTATGACCAATCTCTTCTAGCCTCAAAAGGATGCACAATTGAATCCAAGGCTGGAGTATTTGATCAGATGACACCGGCGGAGAGGCGATATCTCGAGCAGGCAGAGAGGCTTCAAGCTCAAAGGCTTGCCCAAATGGCCAAGAAATCGCATCGCGATCGGGTTCAGGAATTCAATCAGTATCTGGCTAACCTAACTGAGCATTACGACATCCCCAAAGTAGGCCCTGGTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

113

Amino Acids

12.87

Weight (kDa)

9.85

Isoelectric Point (pI)

42.07

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 264
AciI CCGC 1 cut(s) 188
AclWI GGATC 1 cut(s) 80
AcoI YGGCCR 1 cut(s) 246
AcsI RAATTY 1 cut(s) 278
AcuI CTGAAG 1 cut(s) 56
AfiI CCNNNNNNNGG 1 cut(s) 329
AgsI TTSAA 4 cut(s) 58, 152, 224, 283
AjnI CCWGG 1 cut(s) 334
AluBI AGCT 3 cut(s) 34, 40, 227
AluI AGCT 3 cut(s) 34, 40, 227
AlwI GGATC 1 cut(s) 80
AlwNI CAGNNNCTG 1 cut(s) 292
Ama87I CYCGRG 1 cut(s) 203
AoxI GGCC 2 cut(s) 246, 331
ApoI RAATTY 1 cut(s) 278
AspS9I GGNCC 1 cut(s) 332
AsuHPI GGTGA 1 cut(s) 34
AvaI CYCGRG 1 cut(s) 203
BalI TGGCCA 1 cut(s) 248
BbsI GAAGAC 1 cut(s) 92
BcgI CGANNNNNNTGC 2 cut(s) 248, 282
BciT130I CCWGG 1 cut(s) 336
BclI TGATCA 1 cut(s) 172
BfaI CTAG 1 cut(s) 128
BglI GCCNNNNNGGC 1 cut(s) 245
Bme1390I CCNGG 1 cut(s) 336
BmeT110I CYCGRG 1 cut(s) 203
BmgT120I GGNCC 1 cut(s) 332
BmrFI CCNGG 1 cut(s) 336
BmsI GCATC 2 cut(s) 131, 268
BpiI GAAGAC 1 cut(s) 92
BpmI CTGGAG 1 cut(s) 183
BsaJI CCNNGG 2 cut(s) 156, 334
Bsc4I CCNNNNNNNGG 1 cut(s) 329
Bse118I RCCGGY 1 cut(s) 184
BseBI CCWGG 1 cut(s) 336
BseDI CCNNGG 2 cut(s) 156, 334
BseGI GGATG 2 cut(s) 146, 318
BseLI CCNNNNNNNGG 1 cut(s) 329
BseMII CTCAG 1 cut(s) 297
Bsh1236I CGCG 1 cut(s) 264
Bsh1285I CGRYCG 1 cut(s) 268
BshFI GGCC 2 cut(s) 248, 333
BsiEI CGRYCG 1 cut(s) 268
BsiHKCI CYCGRG 1 cut(s) 203
BsiSI CCGG 1 cut(s) 185
BslI CCNNNNNNNGG 1 cut(s) 329
BsnI GGCC 2 cut(s) 248, 333
BsoBI CYCGRG 1 cut(s) 203
Bsp143I GATC 3 cut(s) 72, 172, 265
Bsp68I TCGCGA 1 cut(s) 264
BspACI CCGC 1 cut(s) 188
BspANI GGCC 2 cut(s) 248, 333
BspCNI CTCAG 1 cut(s) 298
BspFNI CGCG 1 cut(s) 264
BspPI GGATC 1 cut(s) 80
BsrFI RCCGGY 1 cut(s) 184
BssAI RCCGGY 1 cut(s) 184
BssECI CCNNGG 2 cut(s) 156, 334
BssMI GATC 3 cut(s) 72, 172, 265
BssT1I CCWWGG 1 cut(s) 156
Bst2UI CCWGG 1 cut(s) 336
Bst6I CTCTTC 1 cut(s) 129
BstC8I GCNNGC 2 cut(s) 210, 237
BstDEI CTNAG 1 cut(s) 306
BstF5I GGATG 2 cut(s) 146, 318
BstFNI CGCG 1 cut(s) 264
BstKTI GATC 3 cut(s) 75, 175, 268
BstMBI GATC 3 cut(s) 72, 172, 265
BstMCI CGRYCG 1 cut(s) 268
BstMWI GCNNNNNNNGC 1 cut(s) 245
BstNI CCWGG 1 cut(s) 336
BstSCI CCNGG 1 cut(s) 334
BstUI CGCG 1 cut(s) 264
BstV2I GAAGAC 1 cut(s) 92
BsuRI GGCC 2 cut(s) 248, 333
BtgZI GCGATG 1 cut(s) 245
BtsCI GGATG 2 cut(s) 146, 318
BtuMI TCGCGA 1 cut(s) 264
Cac8I GCNNGC 2 cut(s) 210, 237
CaiI CAGNNNCTG 1 cut(s) 292
Cfr10I RCCGGY 1 cut(s) 184
Cfr13I GGNCC 1 cut(s) 332
DdeI CTNAG 1 cut(s) 306
DpnI GATC 3 cut(s) 74, 174, 267
DpnII GATC 3 cut(s) 72, 172, 265
EaeI YGGCCR 1 cut(s) 246
Eam1104I CTCTTC 1 cut(s) 129
EarI CTCTTC 1 cut(s) 129
EciI GGCGGA 1 cut(s) 203
Eco130I CCWWGG 1 cut(s) 156
Eco32I GATATC 1 cut(s) 200
Eco57I CTGAAG 1 cut(s) 56
Eco88I CYCGRG 1 cut(s) 203
EcoO109I RGGNCCY 1 cut(s) 332
EcoRI GAATTC 1 cut(s) 278
EcoRII CCWGG 1 cut(s) 334
EcoRV GATATC 1 cut(s) 200
EcoT14I CCWWGG 1 cut(s) 156
ErhI CCWWGG 1 cut(s) 156
FaiI YATR 1 cut(s) 114
FbaI TGATCA 1 cut(s) 172
FokI GGATG 2 cut(s) 153, 305
FspBI CTAG 1 cut(s) 128
GsuI CTGGAG 1 cut(s) 183
HaeIII GGCC 2 cut(s) 248, 333
HapII CCGG 1 cut(s) 185
HinfI GANTC 1 cut(s) 152
HpaII CCGG 1 cut(s) 185
HphI GGTGA 1 cut(s) 34
Hpy188I TCNGA 1 cut(s) 177
Hpy188III TCNNGA 3 cut(s) 203, 263, 275
HpyCH4IV ACGT 2 cut(s) 18, 60
HpyCH4V TGCA 1 cut(s) 144
HpyF10VI GCNNNNNNNGC 1 cut(s) 245
HpyF3I CTNAG 1 cut(s) 306
HpySE526I ACGT 2 cut(s) 18, 60
Ksp22I TGATCA 1 cut(s) 172
Kzo9I GATC 3 cut(s) 72, 172, 265
LpnPI CCDG 6 cut(s) 147, 194, 198, 260, 278, 321
LweI GCATC 2 cut(s) 131, 268
MaeI CTAG 1 cut(s) 128
MaeII ACGT 2 cut(s) 18, 60
MalI GATC 3 cut(s) 74, 174, 267
MboI GATC 3 cut(s) 72, 172, 265
MboII GAAGA 3 cut(s) 94, 97, 116
MfeI CAATTG 1 cut(s) 147
MlsI TGGCCA 1 cut(s) 248
MluCI AATT 2 cut(s) 147, 278
MluNI TGGCCA 1 cut(s) 248
MnlI CCTC 3 cut(s) 142, 186, 210
Mox20I TGGCCA 1 cut(s) 248
MscI TGGCCA 1 cut(s) 248
MseI TTAA 1 cut(s) 340
Msp20I TGGCCA 1 cut(s) 248
MspI CCGG 1 cut(s) 185
MspR9I CCNGG 1 cut(s) 336
MunI CAATTG 1 cut(s) 147
MvaI CCWGG 1 cut(s) 336
MvnI CGCG 1 cut(s) 264
MwoI GCNNNNNNNGC 1 cut(s) 245
NdeII GATC 3 cut(s) 72, 172, 265
NruI TCGCGA 1 cut(s) 264
PaeR7I CTCGAG 1 cut(s) 203
PfeI GAWTC 1 cut(s) 152
Ple19I CGATCG 1 cut(s) 268
Psp6I CCWGG 1 cut(s) 334
PspGI CCWGG 1 cut(s) 334
PspPI GGNCC 1 cut(s) 332
PstNI CAGNNNCTG 1 cut(s) 292
PvuI CGATCG 1 cut(s) 268
RruI TCGCGA 1 cut(s) 264
SaqAI TTAA 1 cut(s) 340
Sau3AI GATC 3 cut(s) 72, 172, 265
Sau96I GGNCC 1 cut(s) 332
ScrFI CCNGG 1 cut(s) 336
SetI ASST 7 cut(s) 21, 36, 42, 63, 70, 229, 303
SfaNI GCATC 2 cut(s) 131, 268
Sfr274I CTCGAG 1 cut(s) 203
SgrAI CRCCGGYG 1 cut(s) 184
SlaI CTCGAG 1 cut(s) 203
SmlI CTYRAG 1 cut(s) 203
SmoI CTYRAG 1 cut(s) 203
Sse9I AATT 2 cut(s) 147, 278
SsiI CCGC 1 cut(s) 188
SspMI CTAG 1 cut(s) 128
StyD4I CCNGG 1 cut(s) 334
StyI CCWWGG 1 cut(s) 156
TaiI ACGT 2 cut(s) 21, 63
TaqI TCGA 1 cut(s) 204
TasI AATT 2 cut(s) 147, 278
TfiI GAWTC 1 cut(s) 152
Tru1I TTAA 1 cut(s) 340
Tru9I TTAA 1 cut(s) 340
XapI RAATTY 1 cut(s) 278
XhoI CTCGAG 1 cut(s) 203
XspI CTAG 1 cut(s) 128
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.