Rmu_sc0011683.1_g000007

Serine threonine-protein phosphatase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0011683.1
Physical Location & Seq
Forward (+)
24537 .. 28861
4325 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0011683.1_g000007.1.cds

Sequence Viewer

Length: 936 bp
atggattcggtcccgtcgaactcgcttgggaacctcgacgagcagattgctcagctcatgcagtgcaagcctttgtccgaacaagaggtaagggggctctgtgaaaaggctaaggagatattgatggaagaaagcaacgttcagcctgtgaaaagcccagtaactatttgcggtgatattcatggacaatttcatgatcttgccgagcttttccgtattggaggaaagtgtccagataccaattatttgtttatgggagattatgtggatcgtggctattattccgttgaaaccgtaactcttttggtggccttgaaggttcgttactctcaacgtataactatcctaagagggaatcatgaaagtcgtcagattactcaagtttatggtttttatgacgagtgcttacggaagtatggtaatgccaatgtttggaagacctttactgatttatttgactattttcccctgacagctttggttgaatctgaaatcttctgcttgcacggtggactttctccctcaattgaaacccttgataacatacgtaattttgaccgtgttcaagaggttcctcatgaaggtcccatgtgtgatcttctttggtctgacccggatgatcgctgtggctggggtatctctcccagaggtgctggatatacttttggccaggacatatccgagcagttcaatcataccaataacttgaagttgattgctagagcacaccagctggtcatggaaggttataactggggtcatgaacaaaaagttgtcaccatattcagtgcacccaactactgttaccgctgtggaaatatggcatcaatcctagaagtcgatgactgcaaaggtcacacattcattcagtttgagccagctccaaggaggggagagccagatgttacccgaagaacacctgattatttcctataa

Protein Analysis

311

Amino Acids

35.49

Weight (kDa)

5.08

Isoelectric Point (pI)

37.2

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 750
AccB7I CCANNNNNTGG 1 cut(s) 432
AciI CCGC 2 cut(s) 171, 808
AclI AACGTT 1 cut(s) 138
AclWI GGATC 1 cut(s) 276
AcoI YGGCCR 1 cut(s) 667
AfiI CCNNNNNNNGG 3 cut(s) 432, 581, 890
AgsI TTSAA 7 cut(s) 290, 316, 485, 530, 566, 691, 709
AjnI CCWGG 1 cut(s) 669
AluBI AGCT 5 cut(s) 55, 208, 476, 733, 881
AluI AGCT 5 cut(s) 55, 208, 476, 733, 881
Alw21I GWGCWC 2 cut(s) 727, 793
Alw44I GTGCAC 1 cut(s) 789
AlwI GGATC 1 cut(s) 276
AoxI GGCC 2 cut(s) 309, 667
ApaLI GTGCAC 1 cut(s) 789
AspS9I GGNCC 2 cut(s) 10, 584
AsuC2I CCSGG 1 cut(s) 614
AsuHPI GGTGA 2 cut(s) 185, 769
AvaII GGWCC 2 cut(s) 10, 584
BaeGI GKGCMC 1 cut(s) 793
BalI TGGCCA 1 cut(s) 669
BanII GRGCYC 1 cut(s) 99
BarI GAAGNNNNNNTAC 2 cut(s) 308, 340
BbsI GAAGAC 1 cut(s) 443
Bbv12I GWGCWC 2 cut(s) 727, 793
BccI CCATC 1 cut(s) 118
BcgI CGANNNNNNTGC 2 cut(s) 29, 63
BciT130I CCWGG 1 cut(s) 671
BcnI CCSGG 1 cut(s) 614
BfaI CTAG 2 cut(s) 720, 833
BlpI GCTNAGC 1 cut(s) 51
Bme1390I CCNGG 2 cut(s) 614, 671
Bme18I GGWCC 2 cut(s) 10, 584
BmgT120I GGNCC 2 cut(s) 10, 584
BmiI GGNNCC 4 cut(s) 12, 32, 573, 586
BmrFI CCNGG 2 cut(s) 614, 671
BmrI ACTGGG 2 cut(s) 152, 763
BmsI GCATC 1 cut(s) 833
BmuI ACTGGG 2 cut(s) 152, 763
BpiI GAAGAC 1 cut(s) 443
Bpu10I CCTNAGC 1 cut(s) 111
Bpu1102I GCTNAGC 1 cut(s) 51
BpuEI CTTGAG 1 cut(s) 363
BpuMI CCSGG 1 cut(s) 614
BsaAI YACGTR 1 cut(s) 548
BsaJI CCNNGG 1 cut(s) 884
BsaXI ACNNNNNCTCC 2 cut(s) 249, 279
Bsc4I CCNNNNNNNGG 3 cut(s) 432, 581, 890
Bse1I ACTGG 2 cut(s) 158, 758
BseBI CCWGG 1 cut(s) 671
BseDI CCNNGG 1 cut(s) 884
BseGI GGATG 1 cut(s) 622
BseLI CCNNNNNNNGG 3 cut(s) 432, 581, 890
BseMII CTCAG 1 cut(s) 65
BseNI ACTGG 2 cut(s) 158, 758
BseSI GKGCMC 1 cut(s) 793
BseYI CCCAGC 1 cut(s) 630
BshFI GGCC 2 cut(s) 311, 669
BsiHKAI GWGCWC 2 cut(s) 727, 793
BsiSI CCGG 1 cut(s) 614
BslFI GGGAC 1 cut(s) 570
BslI CCNNNNNNNGG 3 cut(s) 432, 581, 890
BsmFI GGGAC 1 cut(s) 570
BsnI GGCC 2 cut(s) 311, 669
Bsp1286I GDGCHC 3 cut(s) 99, 727, 793
Bsp143I GATC 4 cut(s) 196, 268, 595, 619
Bsp1720I GCTNAGC 1 cut(s) 51
BspACI CCGC 2 cut(s) 171, 808
BspANI GGCC 2 cut(s) 311, 669
BspCNI CTCAG 1 cut(s) 64
BspHI TCATGA 4 cut(s) 193, 358, 577, 760
BspLI GGNNCC 4 cut(s) 12, 32, 573, 586
BspPI GGATC 1 cut(s) 276
BsrI ACTGG 2 cut(s) 158, 758
BssECI CCNNGG 1 cut(s) 884
BssMI GATC 4 cut(s) 196, 268, 595, 619
BssT1I CCWWGG 1 cut(s) 884
Bst2UI CCWGG 1 cut(s) 671
Bst4CI ACNGT 4 cut(s) 295, 509, 560, 803
BstBAI YACGTR 1 cut(s) 548
BstC8I GCNNGC 3 cut(s) 68, 503, 879
BstDEI CTNAG 3 cut(s) 51, 111, 347
BstENI CCTNNNNNAGG 1 cut(s) 579
BstF5I GGATG 1 cut(s) 622
BstKTI GATC 4 cut(s) 199, 271, 598, 622
BstMBI GATC 4 cut(s) 196, 268, 595, 619
BstMWI GCNNNNNNNGC 1 cut(s) 67
BstNI CCWGG 1 cut(s) 671
BstSCI CCNGG 2 cut(s) 612, 669
BstSLI GKGCMC 1 cut(s) 793
BstSNI TACGTA 1 cut(s) 548
BstV2I GAAGAC 1 cut(s) 443
BsuRI GGCC 2 cut(s) 311, 669
BtsCI GGATG 1 cut(s) 622
BtsI GCAGTG 1 cut(s) 68
BtsIMutI CAGTG 2 cut(s) 68, 793
Cac8I GCNNGC 3 cut(s) 68, 503, 879
CciI TCATGA 4 cut(s) 193, 358, 577, 760
Cfr13I GGNCC 2 cut(s) 10, 584
CviAII CATG 8 cut(s) 58, 182, 194, 359, 578, 589, 739, 761
DdeI CTNAG 3 cut(s) 51, 111, 347
DpnI GATC 4 cut(s) 198, 270, 597, 621
DpnII GATC 4 cut(s) 196, 268, 595, 619
EaeI YGGCCR 1 cut(s) 667
Eco105I TACGTA 1 cut(s) 548
Eco130I CCWWGG 1 cut(s) 884
Eco24I GRGCYC 1 cut(s) 99
Eco47I GGWCC 2 cut(s) 10, 584
EcoNI CCTNNNNNAGG 1 cut(s) 579
EcoO109I RGGNCCY 1 cut(s) 584
EcoRII CCWGG 1 cut(s) 669
EcoT14I CCWWGG 1 cut(s) 884
EcoT38I GRGCYC 1 cut(s) 99
ErhI CCWWGG 1 cut(s) 884
FaeI CATG 8 cut(s) 61, 185, 197, 362, 581, 592, 742, 764
FaqI GGGAC 1 cut(s) 570
FatI CATG 8 cut(s) 57, 181, 193, 358, 577, 588, 738, 760
FokI GGATG 1 cut(s) 629
FriOI GRGCYC 1 cut(s) 99
FspBI CTAG 2 cut(s) 720, 833
GsaI CCCAGC 1 cut(s) 634
HaeIII GGCC 2 cut(s) 311, 669
HapII CCGG 1 cut(s) 614
Hin1II CATG 8 cut(s) 61, 185, 197, 362, 581, 592, 742, 764
HinfI GANTC 3 cut(s) 5, 355, 485
HpaII CCGG 1 cut(s) 614
HphI GGTGA 2 cut(s) 185, 769
Hpy166II GTNNAC 2 cut(s) 512, 791
Hpy188I TCNGA 5 cut(s) 79, 372, 490, 610, 682
Hpy188III TCNNGA 6 cut(s) 194, 233, 359, 566, 578, 761
Hpy8I GTNNAC 2 cut(s) 512, 791
Hpy99I CGWCG 2 cut(s) 19, 41
HpyAV CCTTC 3 cut(s) 310, 575, 737
HpyCH4III ACNGT 4 cut(s) 295, 509, 560, 803
HpyCH4IV ACGT 3 cut(s) 138, 334, 547
HpyCH4V TGCA 5 cut(s) 61, 66, 505, 791, 849
HpyF10VI GCNNNNNNNGC 1 cut(s) 67
HpyF3I CTNAG 3 cut(s) 51, 111, 347
HpySE526I ACGT 3 cut(s) 138, 334, 547
Hsp92II CATG 8 cut(s) 61, 185, 197, 362, 581, 592, 742, 764
Kzo9I GATC 4 cut(s) 196, 268, 595, 619
LmnI GCTCC 1 cut(s) 886
LweI GCATC 1 cut(s) 833
MaeI CTAG 2 cut(s) 720, 833
MaeII ACGT 3 cut(s) 138, 334, 547
MaeIII GTNAC 7 cut(s) 160, 295, 323, 775, 803, 854, 904
MalI GATC 4 cut(s) 198, 270, 597, 621
MboI GATC 4 cut(s) 196, 268, 595, 619
MboII GAAGA 5 cut(s) 140, 448, 487, 590, 924
MfeI CAATTG 1 cut(s) 525
MhlI GDGCHC 3 cut(s) 99, 727, 793
MlsI TGGCCA 1 cut(s) 669
MluCI AATT 4 cut(s) 188, 241, 525, 550
MluNI TGGCCA 1 cut(s) 669
MnlI CCTC 9 cut(s) 44, 79, 215, 344, 532, 562, 585, 641, 882
Mox20I TGGCCA 1 cut(s) 669
MscI TGGCCA 1 cut(s) 669
Msp20I TGGCCA 1 cut(s) 669
MspA1I CMGCKG 2 cut(s) 733, 810
MspI CCGG 1 cut(s) 614
MspR9I CCNGG 2 cut(s) 614, 671
MunI CAATTG 1 cut(s) 525
MvaI CCWGG 1 cut(s) 671
MwoI GCNNNNNNNGC 1 cut(s) 67
NciI CCSGG 1 cut(s) 614
NdeII GATC 4 cut(s) 196, 268, 595, 619
NlaIII CATG 8 cut(s) 61, 185, 197, 362, 581, 592, 742, 764
NlaIV GGNNCC 4 cut(s) 12, 32, 573, 586
NmeAIII GCCGAG 1 cut(s) 229
NmuCI GTSAC 2 cut(s) 775, 854
PagI TCATGA 4 cut(s) 193, 358, 577, 760
PcsI WCGNNNNNNNCGW 1 cut(s) 14
PfeI GAWTC 3 cut(s) 5, 355, 485
PflMI CCANNNNNTGG 1 cut(s) 432
Ppu21I YACGTR 1 cut(s) 548
PpuMI RGGWCCY 1 cut(s) 584
PsiI TTATAA 1 cut(s) 750
Psp1406I AACGTT 1 cut(s) 138
Psp5II RGGWCCY 1 cut(s) 584
Psp6I CCWGG 1 cut(s) 669
PspFI CCCAGC 1 cut(s) 630
PspGI CCWGG 1 cut(s) 669
PspN4I GGNNCC 4 cut(s) 12, 32, 573, 586
PspPI GGNCC 2 cut(s) 10, 584
PspPPI RGGWCCY 1 cut(s) 584
PvuII CAGCTG 1 cut(s) 733
Sau3AI GATC 4 cut(s) 196, 268, 595, 619
Sau96I GGNCC 2 cut(s) 10, 584
ScrFI CCNGG 2 cut(s) 614, 671
SduI GDGCHC 3 cut(s) 99, 727, 793
SfaNI GCATC 1 cut(s) 833
SinI GGWCC 2 cut(s) 10, 584
SmlI CTYRAG 1 cut(s) 378
SmoI CTYRAG 1 cut(s) 378
SnaBI TACGTA 1 cut(s) 548
Sse9I AATT 4 cut(s) 188, 241, 525, 550
SsiI CCGC 2 cut(s) 171, 808
SspMI CTAG 2 cut(s) 720, 833
StyD4I CCNGG 2 cut(s) 612, 669
StyI CCWWGG 1 cut(s) 884
TaaI ACNGT 4 cut(s) 295, 509, 560, 803
TaiI ACGT 3 cut(s) 141, 337, 550
TaqI TCGA 3 cut(s) 17, 36, 840
TasI AATT 4 cut(s) 188, 241, 525, 550
TfiI GAWTC 3 cut(s) 5, 355, 485
TscAI CASTG 2 cut(s) 68, 793
TseFI GTSAC 2 cut(s) 775, 854
Tsp45I GTSAC 2 cut(s) 775, 854
TspDTI ATGAA 6 cut(s) 170, 182, 375, 594, 777, 853
TspGWI ACGGA 3 cut(s) 203, 274, 424
TspRI CASTG 2 cut(s) 68, 793
Van91I CCANNNNNTGG 1 cut(s) 432
VneI GTGCAC 1 cut(s) 789
VpaK11BI GGWCC 2 cut(s) 10, 584
XagI CCTNNNNNAGG 1 cut(s) 579
XspI CTAG 2 cut(s) 720, 833
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.