Rh5CG580300

Serine threonine-protein phosphatase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5C
OG0002422
Physical Location & Seq
Forward (+)
82448260 .. 82453211
4952 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5CG580300.1

Sequence Viewer

Length: 813 bp
ATGGAAGAAAGCAACGTTCAGCCTGTGAAAAGCCCAGTAACTATTTGCGGTGATATTCATGGACAATTTCATGATCTTGCCGAGCTTTTCCGTATTGGAGGAAAGTGTCCAGATACCAATTATTTGTTTATGGGAGATTATGTGGATCGTGGCTATTATTCCGTTGAAACCGTAACTCTTTTGGTGGCCTTGAAGGTTCGTTACTCTCAACGTATAACTATCCTAAGAGGGAATCATGAAAGTCGTCAGATTACTCAAGTATATGGTTTTTATGACGAGTGCTTACGGAAGTATGGTAATGCCAATGTTTGGAAGACCTTTACTGATTTATTTGACTATTTCCCGCTGACAGCTTTGGTTGAATCTGAAATCTTCTGCTTGCACGGTGGACTTTCTCCATCAATTGAAACCCTTGATAACATACGTAATTTTGACCGTGTTCAAGAGGTTCCTCATGAAGGTCCCATGTGTGATCTTCTTTGGTCTGACCCGGATGATCGCTGTGGCTGGGGTATCTCTCCCAGAGGTGCTGGATATACTTTTGGCCAGGACATATCCGAGCAGTTCAATCATACCAATAACTTGAAGTTGATTGCTAGAGCACACCAGCTGGTCATGGAAGGTTATAACTGGGGTCATGAACAAAAAGTTGTCACCATATTCAGTGCACCCAACTACTGTTACCGCTGTGGAAATATGGCATCAATCCTAGAAGTCGATGACTGCAAAGGTCACACATTCATTCAGTTTGAGCCAGCTCCAAGGAGGGGAGAGCCAGATGTTACCCGAAGAACACCTGATTATTTCCTATAA

Protein Analysis

270

Amino Acids

30.96

Weight (kDa)

5.25

Isoelectric Point (pI)

36.38

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Metallophos PF00149 12 - 205 1.5e-47 Calcineurin-like phosphoesterase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 627
AccB7I CCANNNNNTGG 1 cut(s) 309
AciI CCGC 3 cut(s) 48, 344, 685
AclI AACGTT 1 cut(s) 15
AclWI GGATC 1 cut(s) 153
AcoI YGGCCR 1 cut(s) 544
AfiI CCNNNNNNNGG 3 cut(s) 309, 458, 767
AgsI TTSAA 7 cut(s) 167, 193, 362, 407, 443, 568, 586
AjnI CCWGG 1 cut(s) 546
AluBI AGCT 4 cut(s) 85, 353, 610, 758
AluI AGCT 4 cut(s) 85, 353, 610, 758
Alw21I GWGCWC 2 cut(s) 604, 670
Alw44I GTGCAC 1 cut(s) 666
AlwI GGATC 1 cut(s) 153
AoxI GGCC 2 cut(s) 186, 544
ApaLI GTGCAC 1 cut(s) 666
AspS9I GGNCC 1 cut(s) 461
AsuC2I CCSGG 1 cut(s) 491
AsuHPI GGTGA 2 cut(s) 62, 646
AvaII GGWCC 1 cut(s) 461
BaeGI GKGCMC 1 cut(s) 670
BalI TGGCCA 1 cut(s) 546
BarI GAAGNNNNNNTAC 2 cut(s) 185, 217
BbsI GAAGAC 1 cut(s) 320
Bbv12I GWGCWC 2 cut(s) 604, 670
BccI CCATC 1 cut(s) 406
BciT130I CCWGG 1 cut(s) 548
BcnI CCSGG 1 cut(s) 491
BfaI CTAG 2 cut(s) 597, 710
Bme1390I CCNGG 2 cut(s) 491, 548
Bme18I GGWCC 1 cut(s) 461
BmgT120I GGNCC 1 cut(s) 461
BmiI GGNNCC 2 cut(s) 450, 463
BmrFI CCNGG 2 cut(s) 491, 548
BmrI ACTGGG 2 cut(s) 29, 640
BmsI GCATC 1 cut(s) 710
BmuI ACTGGG 2 cut(s) 29, 640
BpiI GAAGAC 1 cut(s) 320
BpuEI CTTGAG 1 cut(s) 240
BpuMI CCSGG 1 cut(s) 491
BsaAI YACGTR 1 cut(s) 425
BsaJI CCNNGG 1 cut(s) 761
BsaXI ACNNNNNCTCC 2 cut(s) 126, 156
Bsc4I CCNNNNNNNGG 3 cut(s) 309, 458, 767
Bse1I ACTGG 2 cut(s) 35, 635
BseBI CCWGG 1 cut(s) 548
BseDI CCNNGG 1 cut(s) 761
BseGI GGATG 1 cut(s) 499
BseLI CCNNNNNNNGG 3 cut(s) 309, 458, 767
BseNI ACTGG 2 cut(s) 35, 635
BseSI GKGCMC 1 cut(s) 670
BseYI CCCAGC 1 cut(s) 507
BshFI GGCC 2 cut(s) 188, 546
BsiHKAI GWGCWC 2 cut(s) 604, 670
BsiSI CCGG 1 cut(s) 491
BslFI GGGAC 1 cut(s) 447
BslI CCNNNNNNNGG 3 cut(s) 309, 458, 767
BsmFI GGGAC 1 cut(s) 447
BsnI GGCC 2 cut(s) 188, 546
Bsp1286I GDGCHC 2 cut(s) 604, 670
Bsp143I GATC 4 cut(s) 73, 145, 472, 496
BspACI CCGC 3 cut(s) 48, 344, 685
BspANI GGCC 2 cut(s) 188, 546
BspHI TCATGA 4 cut(s) 70, 235, 454, 637
BspLI GGNNCC 2 cut(s) 450, 463
BspPI GGATC 1 cut(s) 153
BsrI ACTGG 2 cut(s) 35, 635
BssECI CCNNGG 1 cut(s) 761
BssMI GATC 4 cut(s) 73, 145, 472, 496
BssT1I CCWWGG 1 cut(s) 761
Bst2UI CCWGG 1 cut(s) 548
Bst4CI ACNGT 4 cut(s) 172, 386, 437, 680
BstBAI YACGTR 1 cut(s) 425
BstC8I GCNNGC 2 cut(s) 380, 756
BstDEI CTNAG 1 cut(s) 224
BstENI CCTNNNNNAGG 1 cut(s) 456
BstF5I GGATG 1 cut(s) 499
BstKTI GATC 4 cut(s) 76, 148, 475, 499
BstMBI GATC 4 cut(s) 73, 145, 472, 496
BstNI CCWGG 1 cut(s) 548
BstSCI CCNGG 2 cut(s) 489, 546
BstSLI GKGCMC 1 cut(s) 670
BstSNI TACGTA 1 cut(s) 425
BstV2I GAAGAC 1 cut(s) 320
BsuRI GGCC 2 cut(s) 188, 546
BtsCI GGATG 1 cut(s) 499
BtsIMutI CAGTG 1 cut(s) 670
Cac8I GCNNGC 2 cut(s) 380, 756
CciI TCATGA 4 cut(s) 70, 235, 454, 637
Cfr13I GGNCC 1 cut(s) 461
CviAII CATG 7 cut(s) 59, 71, 236, 455, 466, 616, 638
DdeI CTNAG 1 cut(s) 224
DpnI GATC 4 cut(s) 75, 147, 474, 498
DpnII GATC 4 cut(s) 73, 145, 472, 496
EaeI YGGCCR 1 cut(s) 544
Eco105I TACGTA 1 cut(s) 425
Eco130I CCWWGG 1 cut(s) 761
Eco47I GGWCC 1 cut(s) 461
EcoNI CCTNNNNNAGG 1 cut(s) 456
EcoO109I RGGNCCY 1 cut(s) 461
EcoRII CCWGG 1 cut(s) 546
EcoT14I CCWWGG 1 cut(s) 761
ErhI CCWWGG 1 cut(s) 761
FaeI CATG 7 cut(s) 62, 74, 239, 458, 469, 619, 641
FaqI GGGAC 1 cut(s) 447
FatI CATG 7 cut(s) 58, 70, 235, 454, 465, 615, 637
FauI CCCGC 1 cut(s) 351
FokI GGATG 1 cut(s) 506
FspBI CTAG 2 cut(s) 597, 710
GsaI CCCAGC 1 cut(s) 511
HaeIII GGCC 2 cut(s) 188, 546
HapII CCGG 1 cut(s) 491
Hin1II CATG 7 cut(s) 62, 74, 239, 458, 469, 619, 641
HinfI GANTC 2 cut(s) 232, 362
HpaII CCGG 1 cut(s) 491
HphI GGTGA 2 cut(s) 62, 646
Hpy166II GTNNAC 2 cut(s) 389, 668
Hpy188I TCNGA 4 cut(s) 249, 367, 487, 559
Hpy188III TCNNGA 6 cut(s) 71, 110, 236, 443, 455, 638
Hpy8I GTNNAC 2 cut(s) 389, 668
HpyAV CCTTC 3 cut(s) 187, 452, 614
HpyCH4III ACNGT 4 cut(s) 172, 386, 437, 680
HpyCH4IV ACGT 3 cut(s) 15, 211, 424
HpyCH4V TGCA 3 cut(s) 382, 668, 726
HpyF3I CTNAG 1 cut(s) 224
HpySE526I ACGT 3 cut(s) 15, 211, 424
Hsp92II CATG 7 cut(s) 62, 74, 239, 458, 469, 619, 641
Kzo9I GATC 4 cut(s) 73, 145, 472, 496
LmnI GCTCC 1 cut(s) 763
LweI GCATC 1 cut(s) 710
MaeI CTAG 2 cut(s) 597, 710
MaeII ACGT 3 cut(s) 15, 211, 424
MaeIII GTNAC 7 cut(s) 37, 172, 200, 652, 680, 731, 781
MalI GATC 4 cut(s) 75, 147, 474, 498
MboI GATC 4 cut(s) 73, 145, 472, 496
MboII GAAGA 5 cut(s) 17, 325, 364, 467, 801
MfeI CAATTG 1 cut(s) 402
MhlI GDGCHC 2 cut(s) 604, 670
MlsI TGGCCA 1 cut(s) 546
MluCI AATT 4 cut(s) 65, 118, 402, 427
MluNI TGGCCA 1 cut(s) 546
MnlI CCTC 6 cut(s) 92, 221, 439, 462, 518, 759
Mox20I TGGCCA 1 cut(s) 546
MscI TGGCCA 1 cut(s) 546
Msp20I TGGCCA 1 cut(s) 546
MspA1I CMGCKG 3 cut(s) 346, 610, 687
MspI CCGG 1 cut(s) 491
MspR9I CCNGG 2 cut(s) 491, 548
MunI CAATTG 1 cut(s) 402
MvaI CCWGG 1 cut(s) 548
NciI CCSGG 1 cut(s) 491
NdeII GATC 4 cut(s) 73, 145, 472, 496
NlaIII CATG 7 cut(s) 62, 74, 239, 458, 469, 619, 641
NlaIV GGNNCC 2 cut(s) 450, 463
NmeAIII GCCGAG 1 cut(s) 106
NmuCI GTSAC 2 cut(s) 652, 731
PagI TCATGA 4 cut(s) 70, 235, 454, 637
PfeI GAWTC 2 cut(s) 232, 362
PflMI CCANNNNNTGG 1 cut(s) 309
Ppu21I YACGTR 1 cut(s) 425
PpuMI RGGWCCY 1 cut(s) 461
PsiI TTATAA 1 cut(s) 627
Psp1406I AACGTT 1 cut(s) 15
Psp5II RGGWCCY 1 cut(s) 461
Psp6I CCWGG 1 cut(s) 546
PspFI CCCAGC 1 cut(s) 507
PspGI CCWGG 1 cut(s) 546
PspN4I GGNNCC 2 cut(s) 450, 463
PspPI GGNCC 1 cut(s) 461
PspPPI RGGWCCY 1 cut(s) 461
PvuII CAGCTG 1 cut(s) 610
Sau3AI GATC 4 cut(s) 73, 145, 472, 496
Sau96I GGNCC 1 cut(s) 461
ScrFI CCNGG 2 cut(s) 491, 548
SduI GDGCHC 2 cut(s) 604, 670
SfaNI GCATC 1 cut(s) 710
SinI GGWCC 1 cut(s) 461
SmlI CTYRAG 1 cut(s) 255
SmoI CTYRAG 1 cut(s) 255
SnaBI TACGTA 1 cut(s) 425
Sse9I AATT 4 cut(s) 65, 118, 402, 427
SsiI CCGC 3 cut(s) 48, 344, 685
SspMI CTAG 2 cut(s) 597, 710
StyD4I CCNGG 2 cut(s) 489, 546
StyI CCWWGG 1 cut(s) 761
TaaI ACNGT 4 cut(s) 172, 386, 437, 680
TaiI ACGT 3 cut(s) 18, 214, 427
TaqI TCGA 1 cut(s) 717
TasI AATT 4 cut(s) 65, 118, 402, 427
TfiI GAWTC 2 cut(s) 232, 362
TscAI CASTG 1 cut(s) 670
TseFI GTSAC 2 cut(s) 652, 731
Tsp45I GTSAC 2 cut(s) 652, 731
TspDTI ATGAA 6 cut(s) 47, 59, 252, 471, 654, 730
TspGWI ACGGA 3 cut(s) 80, 151, 301
TspRI CASTG 1 cut(s) 670
Van91I CCANNNNNTGG 1 cut(s) 309
VneI GTGCAC 1 cut(s) 666
VpaK11BI GGWCC 1 cut(s) 461
XagI CCTNNNNNAGG 1 cut(s) 456
XspI CTAG 2 cut(s) 597, 710
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.