Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0013155.1

Orthogroup ID

OG0006269

Physical Location & Seq

Genomic Coordinates Forward (+)

5787 .. 7627

Gene Structure 1841 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0013155.1_g000003.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1179 bp

atggcaactgcaagagccaatgtcttattgccttcgttttgtttcatagcgcttctcgcttctgtgatgtttactggtttttcagtagaagatcgagcaatatacttggttttgatggaagaagactcagttgcattcaatggaggctctccatctttacgcctcaacctaaacagtgaagtttcgaaggctcatgtaaagcaattagaggattctcatgatcaacttctacagagcaatcttgagaccggaagctacagcaagctttacagctttaaacacgttgcaaacggctttgctgtccatacaaccccttctcaggttgaaaagctcaaatatgctccagcagtaaagctggttgagagagatagaggagcaaagttgatgacaacgtacactcctcgcttccttgagttacctgaaggagtatggacacaagaaggaggccaacgtaatgctggtgaaggaattgtgattggttttgtggatagtggcatcaatcctgcacatcgaagttttgcttataatcctttgagccctttcacctccaatatttctcatttttcgggcgcttgtgagactggtcctctattcccagcaacgtcatgcaatggtaaaattgtttcagctaaatttttctcagctggggctcgagccattgctactctcaacgcttcggtggattttctttcacccttcgacgcatatggacatggcagtcatgtggcatcagttgctgctggaaatgctggagttcctgtggttgtgaatggcttcagttatggacgagctggtggaatggcaccacgtgcgcggattgctgtatataaagctgtgtatcctacagtaggaactttggcagatgtagtttctgcaattgatgaagcaattcgagatggagtggatgtcctagcactctctgtcggaccagatgaaccgccattgggtaaagtgaccttcttaagcatgtttgatgtgttcatgctgtatgctcgacgagctggggtcttcgtggtgcaagcagcaagtaatcgagggccagacccttcaagtgtagtgtcttacagcccttgggcagtaggtgtagcctcttccggcacagatagaatttatccttcttctattgttcttggaaatggagcaagaattgaaggtgtgggattatcaggtacatactaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0004175 GO:0004252 GO:0006508 GO:0006807 GO:0007275 GO:0008150 GO:0008152 GO:0008233 GO:0008236 GO:0016787 GO:0017171 GO:0019538 GO:0032501 GO:0032502 GO:0042335 GO:0043170 GO:0044238 GO:0048856 GO:0070011 GO:0071704 GO:0140096 GO:1901564

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Inhibitor_I9 Peptidase_S8

Protein Analysis

392

Amino Acids

41.37

Weight (kDa)

6.45

Isoelectric Point (pI)

29.13

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0006269)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G62340
fragaria_vesca	FvH4_3g01420
malus_domestica	MD05G1352200.v1.1 MD10G1326200.v1.1
prunus_persica	Prupe.4G015500_v2.0.a1
rosa_chinensis	RchiOBHm_Chr5g0002151 RchiOBHm_Chr5g0002191
rosa_laevigata	RLG00000031001 RLG00000031002 RLG00000031007
rosa_multiflora	Rmu_co8154878.1_g000001 Rmu_sc0001492.1_g000001 Rmu_sc0007900.1_g000001 Rmu_sc0013155.1_g000003 Rmu_ssc0000001.1_g000005
rosa_roxburghii	Rroxscaffold_1G00073760
rosa_rugosa	Rorug04G0394700
rosa_samantha	Rh5AG016500 Rh5AG016600 Rh5AG017100 Rh5BG020000 Rh5CG017800 Rh5CG017900 Rh5CG018800 Rh5DG018000
rosa_wichuraiana	Rw2G029690 Rw5G001610

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	525
AasI	GACNNNNNNGTC	1 cut(s)	717
AccB1I	GGYRCC	1 cut(s)	802
AccII	CGCG	1 cut(s)	814
AciI	CCGC	2 cut(s)	814, 938
AcsI	RAATTY	2 cut(s)	632, 1107
AcuI	CTGAAG	2 cut(s)	441, 760
AcvI	CACGTG	1 cut(s)	809
AdeI	CACNNNGTG	1 cut(s)	809
AfaI	GTAC	2 cut(s)	395, 1171
AfeI	AGCGCT	1 cut(s)	51
AfiI	CCNNNNNNNGG	3 cut(s)	319, 848, 944
AflII	CTTAAG	1 cut(s)	961
AflIII	ACRYGT	1 cut(s)	280
AgsI	TTSAA	4 cut(s)	139, 326, 1050, 1151
Alw26I	GTCTC	2 cut(s)	239, 572
AlwNI	CAGNNNCTG	1 cut(s)	737
Ama87I	CYCGRG	1 cut(s)	651
Aor51HI	AGCGCT	1 cut(s)	51
AoxI	GGCC	2 cut(s)	445, 1037
ApeKI	GCWGC	2 cut(s)	737, 1022
ApoI	RAATTY	2 cut(s)	632, 1107
Asp700I	GAANNNNTTC	2 cut(s)	773, 888
AspLEI	GCGC	3 cut(s)	52, 572, 814
AspS9I	GGNCC	3 cut(s)	584, 926, 1037
AsuHPI	GGTGA	3 cut(s)	473, 535, 684
AsuII	TTCGAA	1 cut(s)	185
AvaI	CYCGRG	1 cut(s)	651
AvaII	GGWCC	2 cut(s)	584, 926
BanI	GGYRCC	1 cut(s)	802
BanII	GRGCYC	2 cut(s)	539, 652
BbrPI	CACGTG	1 cut(s)	809
BbsI	GAAGAC	2 cut(s)	129, 1000
BbvI	GCAGC	2 cut(s)	724, 1034
BccI	CCATC	3 cut(s)	109, 160, 890
BceAI	ACGGC	1 cut(s)	307
BciVI	GTATCC	1 cut(s)	849
BclI	TGATCA	1 cut(s)	220
BcoDI	GTCTC	2 cut(s)	239, 572
BfaI	CTAG	1 cut(s)	911
BfmI	CTRYAG	3 cut(s)	230, 256, 843
BfoI	RGCGCY	2 cut(s)	53, 573
BfrI	CTTAAG	1 cut(s)	961
BfuI	GTATCC	1 cut(s)	849
BisI	GCNGC	2 cut(s)	738, 1023
BlsI	GCNGC	2 cut(s)	739, 1024
Bme18I	GGWCC	2 cut(s)	584, 926
BmeT110I	CYCGRG	1 cut(s)	651
BmgT120I	GGNCC	3 cut(s)	584, 926, 1037
BmiI	GGNNCC	1 cut(s)	804
BmsI	GCATC	2 cut(s)	504, 737
BpiI	GAAGAC	2 cut(s)	129, 1000
BpmI	CTGGAG	2 cut(s)	327, 771
Bpu14I	TTCGAA	1 cut(s)	185
BpuEI	CTTGAG	2 cut(s)	263, 431
BsaAI	YACGTR	1 cut(s)	809
BsaI	GGTCTC	1 cut(s)	239
BsaJI	CCNNGG	1 cut(s)	1070
BsaWI	WCCGGW	1 cut(s)	248
BsaXI	ACNNNNNCTCC	6 cut(s)	382, 412, 744, 774, 891, 921
Bsc4I	CCNNNNNNNGG	3 cut(s)	319, 848, 944
Bse1I	ACTGG	2 cut(s)	79, 586
Bse3DI	GCAATG	2 cut(s)	616, 657
BseDI	CCNNGG	1 cut(s)	1070
BseGI	GGATG	1 cut(s)	910
BseLI	CCNNNNNNNGG	3 cut(s)	319, 848, 944
BseMI	GCAATG	2 cut(s)	616, 657
BseMII	CTCAG	3 cut(s)	141, 332, 654
BseNI	ACTGG	2 cut(s)	79, 586
BseRI	GAGGAG	2 cut(s)	387, 390
BseXI	GCAGC	2 cut(s)	724, 1034
BseYI	CCCAGC	3 cut(s)	595, 644, 1001
BsgI	GTGCAG	1 cut(s)	489
Bsh1236I	CGCG	1 cut(s)	814
BshFI	GGCC	2 cut(s)	447, 1039
BshNI	GGYRCC	1 cut(s)	802
BsiHKCI	CYCGRG	1 cut(s)	651
BsiSI	CCGG	2 cut(s)	249, 1095
BslI	CCNNNNNNNGG	3 cut(s)	319, 848, 944
BsmAI	GTCTC	2 cut(s)	239, 572
BsmI	GAATGC	1 cut(s)	134
BsnI	GGCC	2 cut(s)	447, 1039
Bso31I	GGTCTC	1 cut(s)	239
BsoBI	CYCGRG	1 cut(s)	651
Bsp119I	TTCGAA	1 cut(s)	185
Bsp1286I	GDGCHC	2 cut(s)	539, 652
Bsp143I	GATC	2 cut(s)	91, 220
BspACI	CCGC	2 cut(s)	814, 938
BspANI	GGCC	2 cut(s)	447, 1039
BspCNI	CTCAG	3 cut(s)	140, 331, 653
BspFNI	CGCG	1 cut(s)	814
BspHI	TCATGA	1 cut(s)	217
BspLI	GGNNCC	1 cut(s)	804
BspT104I	TTCGAA	1 cut(s)	185
BspT107I	GGYRCC	1 cut(s)	802
BspTI	CTTAAG	1 cut(s)	961
BspTNI	GGTCTC	1 cut(s)	239
BsrDI	GCAATG	2 cut(s)	616, 657
BsrI	ACTGG	2 cut(s)	79, 586
BssECI	CCNNGG	1 cut(s)	1070
BssMI	GATC	2 cut(s)	91, 220
BssT1I	CCWWGG	1 cut(s)	1070
Bst4CI	ACNGT	2 cut(s)	176, 847
Bst6I	CTCTTC	1 cut(s)	1096
BstAFI	CTTAAG	1 cut(s)	961
BstAPI	GCANNNNNTGC	2 cut(s)	734, 809
BstBAI	YACGTR	1 cut(s)	809
BstBI	TTCGAA	1 cut(s)	185
BstC8I	GCNNGC	2 cut(s)	263, 1020
BstDEI	CTNAG	3 cut(s)	127, 318, 640
BstENI	CCTNNNNNAGG	1 cut(s)	846
BstF5I	GGATG	1 cut(s)	910
BstFNI	CGCG	1 cut(s)	814
BstH2I	RGCGCY	2 cut(s)	53, 573
BstHHI	GCGC	3 cut(s)	52, 572, 814
BstKTI	GATC	2 cut(s)	94, 223
BstMAI	GTCTC	2 cut(s)	239, 572
BstMBI	GATC	2 cut(s)	91, 220
BstMWI	GCNNNNNNNGC	6 cut(s)	56, 734, 746, 809, 818, 998
BstNSI	RCATGY	1 cut(s)	970
BstSFI	CTRYAG	3 cut(s)	230, 256, 843
BstUI	CGCG	1 cut(s)	814
BstV1I	GCAGC	2 cut(s)	724, 1034
BstV2I	GAAGAC	2 cut(s)	129, 1000
BsuI	GTATCC	1 cut(s)	849
BsuRI	GGCC	2 cut(s)	447, 1039
BtsCI	GGATG	1 cut(s)	910
BtsIMutI	CAGTG	1 cut(s)	181
Cac8I	GCNNGC	2 cut(s)	263, 1020
CaiI	CAGNNNCTG	1 cut(s)	737
CciI	TCATGA	1 cut(s)	217
CfoI	GCGC	3 cut(s)	52, 572, 814
Cfr13I	GGNCC	3 cut(s)	584, 926, 1037
CseI	GACGC	1 cut(s)	710
Csp6I	GTAC	2 cut(s)	394, 1170
CviAII	CATG	7 cut(s)	194, 218, 606, 713, 722, 967, 982
CviQI	GTAC	2 cut(s)	394, 1170
DdeI	CTNAG	3 cut(s)	127, 318, 640
DpnI	GATC	2 cut(s)	93, 222
DpnII	GATC	2 cut(s)	91, 220
DraI	TTTAAA	1 cut(s)	277
DraIII	CACNNNGTG	1 cut(s)	809
DrdI	GACNNNNNNGTC	1 cut(s)	717
DseDI	GACNNNNNNGTC	1 cut(s)	717
Eam1104I	CTCTTC	1 cut(s)	1096
EarI	CTCTTC	1 cut(s)	1096
Eco130I	CCWWGG	1 cut(s)	1070
Eco24I	GRGCYC	2 cut(s)	539, 652
Eco31I	GGTCTC	1 cut(s)	239
Eco47I	GGWCC	2 cut(s)	584, 926
Eco47III	AGCGCT	1 cut(s)	51
Eco57I	CTGAAG	2 cut(s)	441, 760
Eco72I	CACGTG	1 cut(s)	809
Eco88I	CYCGRG	1 cut(s)	651
EcoNI	CCTNNNNNAGG	1 cut(s)	846
EcoT14I	CCWWGG	1 cut(s)	1070
EcoT38I	GRGCYC	2 cut(s)	539, 652
ErhI	CCWWGG	1 cut(s)	1070
FaeI	CATG	7 cut(s)	197, 221, 609, 716, 725, 970, 985
FalI	AAGNNNNNCTT	2 cut(s)	505, 537
FatI	CATG	7 cut(s)	193, 217, 605, 712, 721, 966, 981
FauNDI	CATATG	1 cut(s)	706
FbaI	TGATCA	1 cut(s)	220
Fnu4HI	GCNGC	2 cut(s)	738, 1023
FokI	GGATG	1 cut(s)	917
FriOI	GRGCYC	2 cut(s)	539, 652
Fsp4HI	GCNGC	2 cut(s)	738, 1023
FspBI	CTAG	1 cut(s)	911
GlaI	GCGC	3 cut(s)	51, 571, 813
GluI	GCNGC	2 cut(s)	738, 1023
GsaI	CCCAGC	3 cut(s)	599, 648, 1005
GsuI	CTGGAG	2 cut(s)	327, 771
HaeII	RGCGCY	2 cut(s)	53, 573
HaeIII	GGCC	2 cut(s)	447, 1039
HapII	CCGG	2 cut(s)	249, 1095
HgaI	GACGC	1 cut(s)	710
HhaI	GCGC	3 cut(s)	52, 572, 814
Hin1II	CATG	7 cut(s)	197, 221, 609, 716, 725, 970, 985
Hin6I	GCGC	3 cut(s)	50, 570, 812
HinP1I	GCGC	3 cut(s)	50, 570, 812
HindIII	AAGCTT	1 cut(s)	263
HinfI	GANTC	2 cut(s)	125, 212
HpaII	CCGG	2 cut(s)	249, 1095
HphI	GGTGA	3 cut(s)	473, 535, 684
Hpy166II	GTNNAC	2 cut(s)	72, 396
Hpy188I	TCNGA	1 cut(s)	926
Hpy188III	TCNNGA	3 cut(s)	218, 242, 893
Hpy8I	GTNNAC	2 cut(s)	72, 396
Hpy99I	CGWCG	2 cut(s)	704, 999
HpyCH4III	ACNGT	2 cut(s)	176, 847
HpyCH4IV	ACGT	5 cut(s)	282, 392, 451, 602, 808
HpyCH4V	TGCA	7 cut(s)	11, 134, 287, 506, 609, 875, 1018
HpyF10VI	GCNNNNNNNGC	6 cut(s)	56, 734, 746, 809, 818, 998
HpyF3I	CTNAG	3 cut(s)	127, 318, 640
HpySE526I	ACGT	5 cut(s)	282, 392, 451, 602, 808
Hsp92II	CATG	7 cut(s)	197, 221, 609, 716, 725, 970, 985
HspAI	GCGC	3 cut(s)	50, 570, 812
Ksp22I	TGATCA	1 cut(s)	220
Kzo9I	GATC	2 cut(s)	91, 220
LmnI	GCTCC	3 cut(s)	346, 374, 1139
Lsp1109I	GCAGC	2 cut(s)	724, 1034
LweI	GCATC	2 cut(s)	504, 737
MaeI	CTAG	1 cut(s)	911
MaeII	ACGT	5 cut(s)	282, 392, 451, 602, 808
MaeIII	GTNAC	2 cut(s)	414, 952
MalI	GATC	2 cut(s)	93, 222
MboI	GATC	2 cut(s)	91, 220
MboII	GAAGA	6 cut(s)	101, 131, 134, 1000, 1083, 1110
MfeI	CAATTG	1 cut(s)	876
MhlI	GDGCHC	2 cut(s)	539, 652
MluCI	AATT	8 cut(s)	203, 468, 618, 632, 876, 888, 1107, 1146
MlyI	GAGTC	1 cut(s)	119
MmeI	TCCRAC	1 cut(s)	904
MroXI	GAANNNNTTC	2 cut(s)	773, 888
MseI	TTAA	2 cut(s)	276, 962
MspA1I	CMGCKG	1 cut(s)	644
MspCI	CTTAAG	1 cut(s)	961
MspI	CCGG	2 cut(s)	249, 1095
MunI	CAATTG	1 cut(s)	876
Mva1269I	GAATGC	1 cut(s)	134
MvnI	CGCG	1 cut(s)	814
MwoI	GCNNNNNNNGC	6 cut(s)	56, 734, 746, 809, 818, 998
NdeI	CATATG	1 cut(s)	706
NdeII	GATC	2 cut(s)	91, 220
NlaIII	CATG	7 cut(s)	197, 221, 609, 716, 725, 970, 985
NlaIV	GGNNCC	1 cut(s)	804
NmuCI	GTSAC	1 cut(s)	952
NspI	RCATGY	1 cut(s)	970
NspV	TTCGAA	1 cut(s)	185
PaeR7I	CTCGAG	1 cut(s)	651
PagI	TCATGA	1 cut(s)	217
PctI	GAATGC	1 cut(s)	134
PdmI	GAANNNNTTC	2 cut(s)	773, 888
PfeI	GAWTC	1 cut(s)	212
PkrI	GCNGC	2 cut(s)	739, 1024
PleI	GAGTC	1 cut(s)	119
PmaCI	CACGTG	1 cut(s)	809
PmlI	CACGTG	1 cut(s)	809
PpsI	GAGTC	1 cut(s)	119
Ppu21I	YACGTR	1 cut(s)	809
PsiI	TTATAA	1 cut(s)	525
PspCI	CACGTG	1 cut(s)	809
PspFI	CCCAGC	3 cut(s)	595, 644, 1001
PspN4I	GGNNCC	1 cut(s)	804
PspPI	GGNCC	3 cut(s)	584, 926, 1037
PspXI	VCTCGAGB	1 cut(s)	651
PstNI	CAGNNNCTG	1 cut(s)	737
PvuII	CAGCTG	1 cut(s)	644
RsaI	GTAC	2 cut(s)	395, 1171
RsaNI	GTAC	2 cut(s)	394, 1170
SaqAI	TTAA	2 cut(s)	276, 962
SatI	GCNGC	2 cut(s)	738, 1023
Sau3AI	GATC	2 cut(s)	91, 220
Sau96I	GGNCC	3 cut(s)	584, 926, 1037
SchI	GAGTC	1 cut(s)	119
SduI	GDGCHC	2 cut(s)	539, 652
SfaNI	GCATC	2 cut(s)	504, 737
SfcI	CTRYAG	3 cut(s)	230, 256, 843
Sfr274I	CTCGAG	1 cut(s)	651
SfuI	TTCGAA	1 cut(s)	185
SinI	GGWCC	2 cut(s)	584, 926
SlaI	CTCGAG	1 cut(s)	651
SmlI	CTYRAG	4 cut(s)	242, 410, 651, 961
SmoI	CTYRAG	4 cut(s)	242, 410, 651, 961
Sse9I	AATT	8 cut(s)	203, 468, 618, 632, 876, 888, 1107, 1146
SsiI	CCGC	2 cut(s)	814, 938
SspI	AATATT	1 cut(s)	553
SspMI	CTAG	1 cut(s)	911
StyI	CCWWGG	1 cut(s)	1070
TaaI	ACNGT	2 cut(s)	176, 847
TaiI	ACGT	5 cut(s)	285, 395, 454, 605, 811
TaqI	TCGA	8 cut(s)	94, 185, 511, 652, 699, 892, 994, 1033
TasI	AATT	8 cut(s)	203, 468, 618, 632, 876, 888, 1107, 1146
TfiI	GAWTC	1 cut(s)	212
Tru1I	TTAA	2 cut(s)	276, 962
Tru9I	TTAA	2 cut(s)	276, 962
TscAI	CASTG	1 cut(s)	181
TseFI	GTSAC	1 cut(s)	952
TseI	GCWGC	2 cut(s)	737, 1022
Tsp45I	GTSAC	1 cut(s)	952
TspDTI	ATGAA	4 cut(s)	34, 897, 948, 970
TspRI	CASTG	1 cut(s)	181
Vha464I	CTTAAG	1 cut(s)	961
VpaK11BI	GGWCC	2 cut(s)	584, 926
XagI	CCTNNNNNAGG	1 cut(s)	846
XapI	RAATTY	2 cut(s)	632, 1107
XceI	RCATGY	1 cut(s)	970
XcmI	CCANNNNNNNNNTGG	1 cut(s)	455
XhoI	CTCGAG	1 cut(s)	651
XmnI	GAANNNNTTC	2 cut(s)	773, 888
XspI	CTAG	1 cut(s)	911

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.