Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0017785.1

Orthogroup ID

OG0003247

Physical Location & Seq

Genomic Coordinates Reverse (-)

18273 .. 22232

Gene Structure 3960 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0017785.1_g000007.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1713 bp

atggcgcgttacatcccacgcgccactctcatatccatcacccccattcccatccgaaacaccacccccagacagaattcaatcctccctccccaaccgcaccgtttcgacgcctccaaagcctcgctcttcttcggccggagattccacgccctctgcggcggcgactggagagctcgtccgagaccgtcgttacgcatctgtgctgcgcagagagactaccggaaagtgaggcggcgagccccgaagagcaaggacaaggagctcgagctcaacgtcagcatttgcatcgaagaagagttgcctgacgatcctgaaatccttgggatagcggagttgctcaggattaatgttccgatggcaatgaagctagcgtttgatggcttgaaagattcggagtataagaccagggacgatggcattagtgacgtcggacggtttcagagcgtggagctttcggtgatgctctgcaatgacgagtttatccgaaagcttaacaaagaatggagagatgaggaccatgctaccgatgtgctttcaatgtcacaacatgtccctgagcttaggcttcccattcttatgttgggtgacgttgtgatttctgttgagactgcggctagacaagcagaagaaagaggacatacgattcttgacgagatacgtattctcatgatacatggattgctgcatctattaggatttgatcatgagattagcgaagaagccgaagtggaaatggagaaggaggaggagcttctcttgaagagccttgggtggacgggaaaaggattgattcagagtgcgtccaatgctgaaatcaatgcaatttcccatgaggagaaacaggatgacaggaagagagaaggcagccttcgatactataaaccaaagttcaaatatatattctgcgatatggatggcacccttctcaacagtaaaactcaaatcagttcaacaactgcggaggctcttaaagaggtctcatcaaggggtgtgaaaatagtgatagcaacaggaaaaactcgctcagctgtgatcaacatttttaaaatggtagacttggcaggaaaagatggcattgtttcagaattttctcctggggttttctgccagggattgcttgtttatggtaagcaaggtcgggaaatctttaaagggaatttagatccaaatgtctgcagagaggcgtgtctttactcttgggagaataggatacctcttattgcttacagtgaggatcgttgcttcactctatttgaccacccactagttgactcactacatactgtatatcatgagccaaagggggagatcatgccttcagttgagcatctcttggctgctggtgacatacagaaagtaatcttcatggacactgccgaaggagtcgcaactactttgaggccatactggtcaggagcaattagagatcgtgcagcagttgttcaagctcagccggacatgcttgaaattgtccctccggggacctcaaaagggagtggagtaaaattgctgcttgatcatttgggcatcactccgaaggagatcatggctattggcgatggagaaaatgacgttgagatgcttgaactagcttctttgggtgttgctcttagcaatggttcagagaaaacaaaagctgtggctaatttaattggtgccagtaacgacgaagatggtgcagctgatgcgatctaccggtatgcattttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000287 GO:0003674 GO:0003824 GO:0005488 GO:0006793 GO:0006796 GO:0008150 GO:0008152 GO:0009987 GO:0016311 GO:0016787 GO:0016788 GO:0016791 GO:0019203 GO:0042578 GO:0043167 GO:0043169 GO:0044237 GO:0046872 GO:0050308

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Hydrolase_3 UPF0054

Protein Analysis

570

Amino Acids

63.59

Weight (kDa)

5.54

Isoelectric Point (pI)

36.4

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003247)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G25870
fragaria_vesca	FvH4_2g35220 FvH4_2g35230
malus_domestica	MD08G1110200.v1.1 MD08G1110300.v1.1
prunus_persica	Prupe.1G444400_v2.0.a1 Prupe.1G444400_v2.0.a1 Prupe.1G444400_v2.0.a1 Prupe.1G444400_v2.0.a1 Prupe.1G444400_v2.0.a1 Prupe.1G444500_v2.0.a1 Prupe.1G444500_v2.0.a1 Prupe.1G444500_v2.0.a1
pyrus_communis	pycom08g09180 pycom15g08410
rosa_chinensis	RchiOBHm_Chr6g0306701 RchiOBHm_Chr6g0306711
rosa_laevigata	RLG00000010771 RLG00000010772
rosa_multiflora	Rmu_sc0005201.1_g000001 Rmu_sc0017725.1_g000001 Rmu_sc0017785.1_g000007 Rmu_sc0017785.1_g000008 Rmu_sc0017786.1_g000007
rosa_roxburghii	Rroxscaffold_7G00161520 Rroxscaffold_7G00161530
rosa_rugosa	Rorug06G0351700 Rorug06G0351700
rosa_samantha	Rh6AG464100 Rh6AG464200 Rh6BG436800 Rh6BG436900 Rh6CG478300 Rh6DG465000 Rh6DG465100
rosa_wichuraiana	Rw6G040430 Rw6G040440

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AatII	GACGTC	1 cut(s)	432
Acc16I	TGCGCA	1 cut(s)	210
AccB1I	GGYRCC	2 cut(s)	920, 1658
AccI	GTMKAC	1 cut(s)	1056
AccII	CGCG	2 cut(s)	7, 21
AciI	CCGC	7 cut(s)	98, 159, 162, 235, 332, 614, 962
AclWI	GGATC	3 cut(s)	305, 1160, 1245
AcoI	YGGCCR	1 cut(s)	136
AcsI	RAATTY	3 cut(s)	76, 1088, 1159
AcuI	CTGAAG	1 cut(s)	1305
AcyI	GRCGYC	2 cut(s)	111, 429
AfiI	CCNNNNNNNGG	1 cut(s)	1494
AflIII	ACRYGT	1 cut(s)	550
AgeI	ACCGGT	1 cut(s)	1698
AgsI	TTSAA	9 cut(s)	81, 388, 540, 763, 895, 954, 1448, 1469, 1589
AhlI	ACTAGT	1 cut(s)	1267
AjnI	CCWGG	3 cut(s)	407, 1096, 1110
Alw21I	GWGCWC	3 cut(s)	178, 267, 273
Alw26I	GTCTC	4 cut(s)	178, 210, 602, 985
AlwI	GGATC	3 cut(s)	305, 1160, 1245
Ama87I	CYCGRG	1 cut(s)	266
AoxI	GGCC	2 cut(s)	136, 1403
ApeKI	GCWGC	7 cut(s)	206, 685, 867, 1340, 1436, 1513, 1682
ApoI	RAATTY	3 cut(s)	76, 1088, 1159
AseI	ATTAAT	1 cut(s)	348
AsiGI	ACCGGT	1 cut(s)	1698
AspLEI	GCGC	3 cut(s)	7, 23, 211
AspS9I	GGNCC	2 cut(s)	517, 1485
AsuC2I	CCSGG	1 cut(s)	1482
AsuHPI	GGTGA	4 cut(s)	31, 472, 599, 1358
AsuNHI	GCTAGC	1 cut(s)	370
AvaI	CYCGRG	1 cut(s)	266
AvaII	GGWCC	2 cut(s)	517, 1485
BanI	GGYRCC	2 cut(s)	920, 1658
BanII	GRGCYC	4 cut(s)	178, 244, 267, 273
Bbv12I	GWGCWC	3 cut(s)	178, 267, 273
BbvI	GCAGC	7 cut(s)	193, 672, 879, 1327, 1448, 1500, 1694
BccI	CCATC	9 cut(s)	44, 59, 352, 374, 410, 911, 1067, 1556, 1670
BcgI	CGANNNNNNTGC	4 cut(s)	271, 305, 1661, 1695
BciT130I	CCWGG	3 cut(s)	409, 1098, 1112
BciVI	GTATCC	1 cut(s)	1206
BclI	TGATCA	3 cut(s)	703, 1035, 1519
BcnI	CCSGG	1 cut(s)	1482
BcoDI	GTCTC	4 cut(s)	178, 210, 602, 985
BcuI	ACTAGT	1 cut(s)	1267
BfaI	CTAG	4 cut(s)	371, 618, 1268, 1592
BfmI	CTRYAG	1 cut(s)	1177
BfuI	GTATCC	1 cut(s)	1206
BlpI	GCTNAGC	2 cut(s)	1027, 1452
Bme1390I	CCNGG	4 cut(s)	409, 1098, 1112, 1482
Bme18I	GGWCC	2 cut(s)	517, 1485
BmeT110I	CYCGRG	1 cut(s)	266
BmgT120I	GGNCC	2 cut(s)	517, 1485
BmiI	GGNNCC	3 cut(s)	922, 1486, 1660
BmrFI	CCNGG	4 cut(s)	409, 1098, 1112, 1482
BmsI	GCATC	8 cut(s)	207, 297, 453, 697, 1339, 1539, 1572, 1678
BmtI	GCTAGC	1 cut(s)	374
BpmI	CTGGAG	1 cut(s)	190
Bpu10I	CCTNAGC	3 cut(s)	341, 558, 563
Bpu1102I	GCTNAGC	2 cut(s)	1027, 1452
BpuMI	CCSGG	1 cut(s)	1482
BsaAI	YACGTR	1 cut(s)	662
BsaHI	GRCGYC	2 cut(s)	111, 429
BsaI	GGTCTC	2 cut(s)	178, 985
BsaJI	CCNNGG	6 cut(s)	322, 408, 769, 1097, 1111, 1481
BsaWI	WCCGGW	2 cut(s)	222, 1698
BsaXI	ACNNNNNCTCC	2 cut(s)	163, 193
Bsc4I	CCNNNNNNNGG	1 cut(s)	1494
Bse118I	RCCGGY	1 cut(s)	1698
Bse1I	ACTGG	3 cut(s)	173, 1415, 1662
Bse3DI	GCAATG	3 cut(s)	369, 478, 1624
BseBI	CCWGG	3 cut(s)	409, 1098, 1112
BseDI	CCNNGG	6 cut(s)	322, 408, 769, 1097, 1111, 1481
BseGI	GGATG	4 cut(s)	12, 51, 853, 922
BseLI	CCNNNNNNNGG	1 cut(s)	1494
BseMI	GCAATG	3 cut(s)	369, 478, 1624
BseMII	CTCAG	4 cut(s)	355, 549, 1041, 1466
BseNI	ACTGG	3 cut(s)	173, 1415, 1662
BseRI	GAGGAG	3 cut(s)	761, 764, 851
BseX3I	CGGCCG	1 cut(s)	136
BseXI	GCAGC	7 cut(s)	193, 672, 879, 1327, 1448, 1500, 1694
BsgI	GTGCAG	2 cut(s)	1455, 1701
Bsh1236I	CGCG	2 cut(s)	7, 21
Bsh1285I	CGRYCG	1 cut(s)	139
BshFI	GGCC	2 cut(s)	138, 1405
BshNI	GGYRCC	2 cut(s)	920, 1658
BshTI	ACCGGT	1 cut(s)	1698
BsiEI	CGRYCG	1 cut(s)	139
BsiHKAI	GWGCWC	3 cut(s)	178, 267, 273
BsiHKCI	CYCGRG	1 cut(s)	266
BsiSI	CCGG	5 cut(s)	139, 223, 1457, 1481, 1699
BslFI	GGGAC	4 cut(s)	425, 539, 1460, 1498
BslI	CCNNNNNNNGG	1 cut(s)	1494
BsmAI	GTCTC	4 cut(s)	178, 210, 602, 985
BsmFI	GGGAC	4 cut(s)	425, 539, 1460, 1498
BsnI	GGCC	2 cut(s)	138, 1405
Bso31I	GGTCTC	2 cut(s)	178, 985
BsoBI	CYCGRG	1 cut(s)	266
Bsp1286I	GDGCHC	4 cut(s)	178, 244, 267, 273
Bsp1720I	GCTNAGC	2 cut(s)	1027, 1452
BspACI	CCGC	7 cut(s)	98, 159, 162, 235, 332, 614, 962
BspANI	GGCC	2 cut(s)	138, 1405
BspCNI	CTCAG	4 cut(s)	354, 550, 1040, 1465
BspFNI	CGCG	2 cut(s)	7, 21
BspHI	TCATGA	3 cut(s)	669, 706, 1294
BspLI	GGNNCC	3 cut(s)	922, 1486, 1660
BspMAI	CTGCAG	1 cut(s)	1181
BspOI	GCTAGC	1 cut(s)	374
BspPI	GGATC	3 cut(s)	305, 1160, 1245
BspQI	GCTCTTC	3 cut(s)	134, 242, 758
BspT107I	GGYRCC	2 cut(s)	920, 1658
BspTNI	GGTCTC	2 cut(s)	178, 985
BsrDI	GCAATG	3 cut(s)	369, 478, 1624
BsrFI	RCCGGY	1 cut(s)	1698
BsrI	ACTGG	3 cut(s)	173, 1415, 1662
BssAI	RCCGGY	1 cut(s)	1698
BssECI	CCNNGG	6 cut(s)	322, 408, 769, 1097, 1111, 1481
BssNI	GRCGYC	2 cut(s)	111, 429
BssT1I	CCWWGG	2 cut(s)	322, 769
Bst2UI	CCWGG	3 cut(s)	409, 1098, 1112
Bst4CI	ACNGT	6 cut(s)	104, 189, 438, 935, 1232, 1288
Bst6I	CTCTTC	5 cut(s)	134, 242, 291, 758, 851
BstACI	GRCGYC	2 cut(s)	111, 429
BstAPI	GCANNNNNTGC	1 cut(s)	1688
BstBAI	YACGTR	1 cut(s)	662
BstC8I	GCNNGC	2 cut(s)	240, 372
BstDEI	CTNAG	6 cut(s)	341, 558, 563, 1027, 1452, 1613
BstF5I	GGATG	4 cut(s)	12, 51, 853, 922
BstFNI	CGCG	2 cut(s)	7, 21
BstHHI	GCGC	3 cut(s)	7, 23, 211
BstMAI	GTCTC	4 cut(s)	178, 210, 602, 985
BstMCI	CGRYCG	1 cut(s)	139
BstMWI	GCNNNNNNNGC	5 cut(s)	119, 623, 809, 1462, 1688
BstNI	CCWGG	3 cut(s)	409, 1098, 1112
BstNSI	RCATGY	2 cut(s)	554, 1465
BstSCI	CCNGG	4 cut(s)	407, 1096, 1110, 1480
BstSFI	CTRYAG	1 cut(s)	1177
BstSNI	TACGTA	1 cut(s)	662
BstUI	CGCG	2 cut(s)	7, 21
BstV1I	GCAGC	7 cut(s)	193, 672, 879, 1327, 1448, 1500, 1694
BstX2I	RGATCY	1 cut(s)	1165
BstYI	RGATCY	1 cut(s)	1165
BstZI	CGGCCG	1 cut(s)	136
BsuI	GTATCC	1 cut(s)	1206
BsuRI	GGCC	2 cut(s)	138, 1405
BtgZI	GCGATG	1 cut(s)	1575
BtsCI	GGATG	4 cut(s)	12, 51, 853, 922
BtsI	GCAGTG	1 cut(s)	1374
BtsIMutI	CAGTG	2 cut(s)	1237, 1374
Cac8I	GCNNGC	2 cut(s)	240, 372
CciI	TCATGA	3 cut(s)	669, 706, 1294
CfoI	GCGC	3 cut(s)	7, 23, 211
Cfr10I	RCCGGY	1 cut(s)	1698
Cfr13I	GGNCC	2 cut(s)	517, 1485
CseI	GACGC	2 cut(s)	119, 792
CspAI	ACCGGT	1 cut(s)	1698
CspCI	CAANNNNNGTGG	2 cut(s)	1623, 1658
DdeI	CTNAG	6 cut(s)	341, 558, 563, 1027, 1452, 1613
DraI	TTTAAA	2 cut(s)	1048, 1153
EaeI	YGGCCR	1 cut(s)	136
EagI	CGGCCG	1 cut(s)	136
Eam1104I	CTCTTC	5 cut(s)	134, 242, 291, 758, 851
EarI	CTCTTC	5 cut(s)	134, 242, 291, 758, 851
Ecl136II	GAGCTC	3 cut(s)	176, 265, 271
EclXI	CGGCCG	1 cut(s)	136
Eco105I	TACGTA	1 cut(s)	662
Eco130I	CCWWGG	2 cut(s)	322, 769
Eco24I	GRGCYC	4 cut(s)	178, 244, 267, 273
Eco31I	GGTCTC	2 cut(s)	178, 985
Eco47I	GGWCC	2 cut(s)	517, 1485
Eco52I	CGGCCG	1 cut(s)	136
Eco53kI	GAGCTC	3 cut(s)	176, 265, 271
Eco57I	CTGAAG	1 cut(s)	1305
Eco88I	CYCGRG	1 cut(s)	266
EcoICRI	GAGCTC	3 cut(s)	176, 265, 271
EcoO109I	RGGNCCY	1 cut(s)	1485
EcoRI	GAATTC	1 cut(s)	76
EcoRII	CCWGG	3 cut(s)	407, 1096, 1110
EcoT14I	CCWWGG	2 cut(s)	322, 769
EcoT22I	ATGCAT	1 cut(s)	1708
EcoT38I	GRGCYC	4 cut(s)	178, 244, 267, 273
ErhI	CCWWGG	2 cut(s)	322, 769
FalI	AAGNNNNNCTT	2 cut(s)	855, 887
FaqI	GGGAC	4 cut(s)	425, 539, 1460, 1498
FbaI	TGATCA	3 cut(s)	703, 1035, 1519
FblI	GTMKAC	1 cut(s)	1056
FokI	GGATG	3 cut(s)	38, 860, 929
FriOI	GRGCYC	4 cut(s)	178, 244, 267, 273
FspBI	CTAG	4 cut(s)	371, 618, 1268, 1592
FspI	TGCGCA	1 cut(s)	210
GlaI	GCGC	3 cut(s)	6, 22, 210
GsuI	CTGGAG	1 cut(s)	190
HaeIII	GGCC	2 cut(s)	138, 1405
HapII	CCGG	5 cut(s)	139, 223, 1457, 1481, 1699
HgaI	GACGC	2 cut(s)	119, 792
HhaI	GCGC	3 cut(s)	7, 23, 211
Hin1I	GRCGYC	2 cut(s)	111, 429
Hin6I	GCGC	3 cut(s)	5, 21, 209
HinP1I	GCGC	3 cut(s)	5, 21, 209
HincII	GTYRAC	1 cut(s)	1273
HindII	GTYRAC	1 cut(s)	1273
HindIII	AAGCTT	1 cut(s)	491
HinfI	GANTC	6 cut(s)	144, 392, 646, 793, 1274, 1386
HpaII	CCGG	5 cut(s)	139, 223, 1457, 1481, 1699
HphI	GGTGA	4 cut(s)	31, 472, 599, 1358
Hpy166II	GTNNAC	3 cut(s)	777, 1057, 1273
Hpy188III	TCNNGA	9 cut(s)	314, 343, 650, 670, 707, 760, 1142, 1295, 1416
Hpy8I	GTNNAC	3 cut(s)	777, 1057, 1273
Hpy99I	CGWCG	4 cut(s)	113, 193, 434, 1673
HpyAV	CCTTC	7 cut(s)	736, 857, 881, 935, 1329, 1376, 1534
HpyCH4III	ACNGT	6 cut(s)	104, 189, 438, 935, 1232, 1288
HpyCH4IV	ACGT	5 cut(s)	276, 429, 591, 661, 1575
HpyCH4V	TGCA	8 cut(s)	288, 471, 688, 824, 1179, 1436, 1682, 1706
HpyF10VI	GCNNNNNNNGC	5 cut(s)	119, 623, 809, 1462, 1688
HpyF3I	CTNAG	6 cut(s)	341, 558, 563, 1027, 1452, 1613
HpySE526I	ACGT	5 cut(s)	276, 429, 591, 661, 1575
Hsp92I	GRCGYC	2 cut(s)	111, 429
HspAI	GCGC	3 cut(s)	5, 21, 209
Ksp22I	TGATCA	3 cut(s)	703, 1035, 1519
LguI	GCTCTTC	3 cut(s)	134, 242, 758
LmnI	GCTCC	4 cut(s)	262, 451, 751, 1418
Lsp1109I	GCAGC	7 cut(s)	193, 672, 879, 1327, 1448, 1500, 1694
LweI	GCATC	8 cut(s)	207, 297, 453, 697, 1339, 1539, 1572, 1678
MaeI	CTAG	4 cut(s)	371, 618, 1268, 1592
MaeII	ACGT	5 cut(s)	276, 429, 591, 661, 1575
MaeIII	GTNAC	7 cut(s)	8, 192, 425, 543, 587, 1346, 1664
MflI	RGATCY	1 cut(s)	1165
MhlI	GDGCHC	4 cut(s)	178, 244, 267, 273
MluCI	AATT	9 cut(s)	76, 825, 1088, 1159, 1422, 1470, 1508, 1648, 1653
MlyI	GAGTC	2 cut(s)	1268, 1395
MmeI	TCCRAC	1 cut(s)	412
Mph1103I	ATGCAT	1 cut(s)	1708
MseI	TTAA	6 cut(s)	348, 495, 972, 1047, 1152, 1652
MslI	CAYNNNNRTG	1 cut(s)	578
MspA1I	CMGCKG	2 cut(s)	1031, 1685
MspI	CCGG	5 cut(s)	139, 223, 1457, 1481, 1699
MspR9I	CCNGG	4 cut(s)	409, 1098, 1112, 1482
MvaI	CCWGG	3 cut(s)	409, 1098, 1112
MvnI	CGCG	2 cut(s)	7, 21
MwoI	GCNNNNNNNGC	5 cut(s)	119, 623, 809, 1462, 1688
NciI	CCSGG	1 cut(s)	1482
NheI	GCTAGC	1 cut(s)	370
NlaIV	GGNNCC	3 cut(s)	922, 1486, 1660
NmuCI	GTSAC	4 cut(s)	425, 543, 587, 1346
NsbI	TGCGCA	1 cut(s)	210
NsiI	ATGCAT	1 cut(s)	1708
NspI	RCATGY	2 cut(s)	554, 1465
PaeR7I	CTCGAG	1 cut(s)	266
PagI	TCATGA	3 cut(s)	669, 706, 1294
PciI	ACATGT	1 cut(s)	550
PciSI	GCTCTTC	3 cut(s)	134, 242, 758
PcsI	WCGNNNNNNNCGW	1 cut(s)	273
PfeI	GAWTC	4 cut(s)	144, 392, 646, 793
PinAI	ACCGGT	1 cut(s)	1698
PleI	GAGTC	2 cut(s)	1268, 1394
PpsI	GAGTC	2 cut(s)	1268, 1394
Ppu21I	YACGTR	1 cut(s)	662
PpuMI	RGGWCCY	1 cut(s)	1485
PscI	ACATGT	1 cut(s)	550
PshBI	ATTAAT	1 cut(s)	348
Psp124BI	GAGCTC	3 cut(s)	178, 267, 273
Psp5II	RGGWCCY	1 cut(s)	1485
Psp6I	CCWGG	3 cut(s)	407, 1096, 1110
PspGI	CCWGG	3 cut(s)	407, 1096, 1110
PspN4I	GGNNCC	3 cut(s)	922, 1486, 1660
PspPI	GGNCC	2 cut(s)	517, 1485
PspPPI	RGGWCCY	1 cut(s)	1485
PspXI	VCTCGAGB	1 cut(s)	266
PstI	CTGCAG	1 cut(s)	1181
PsuI	RGATCY	1 cut(s)	1165
PvuII	CAGCTG	2 cut(s)	1031, 1685
RseI	CAYNNNNRTG	1 cut(s)	578
SacI	GAGCTC	3 cut(s)	178, 267, 273
SapI	GCTCTTC	3 cut(s)	134, 242, 758
SaqAI	TTAA	6 cut(s)	348, 495, 972, 1047, 1152, 1652
Sau96I	GGNCC	2 cut(s)	517, 1485
SchI	GAGTC	2 cut(s)	1268, 1395
ScrFI	CCNGG	4 cut(s)	409, 1098, 1112, 1482
SduI	GDGCHC	4 cut(s)	178, 244, 267, 273
SfaNI	GCATC	8 cut(s)	207, 297, 453, 697, 1339, 1539, 1572, 1678
SfcI	CTRYAG	1 cut(s)	1177
Sfr274I	CTCGAG	1 cut(s)	266
SinI	GGWCC	2 cut(s)	517, 1485
SlaI	CTCGAG	1 cut(s)	266
SmiMI	CAYNNNNRTG	1 cut(s)	578
SmlI	CTYRAG	1 cut(s)	266
SmoI	CTYRAG	1 cut(s)	266
SnaBI	TACGTA	1 cut(s)	662
SpeI	ACTAGT	1 cut(s)	1267
Sse9I	AATT	9 cut(s)	76, 825, 1088, 1159, 1422, 1470, 1508, 1648, 1653
SsiI	CCGC	7 cut(s)	98, 159, 162, 235, 332, 614, 962
SspMI	CTAG	4 cut(s)	371, 618, 1268, 1592
SstI	GAGCTC	3 cut(s)	178, 267, 273
StyD4I	CCNGG	4 cut(s)	407, 1096, 1110, 1480
StyI	CCWWGG	2 cut(s)	322, 769
TaaI	ACNGT	6 cut(s)	104, 189, 438, 935, 1232, 1288
TaiI	ACGT	5 cut(s)	279, 432, 594, 664, 1578
TaqI	TCGA	4 cut(s)	108, 267, 291, 874
TasI	AATT	9 cut(s)	76, 825, 1088, 1159, 1422, 1470, 1508, 1648, 1653
TauI	GCSGC	4 cut(s)	162, 165, 238, 617
TfiI	GAWTC	4 cut(s)	144, 392, 646, 793
Tru1I	TTAA	6 cut(s)	348, 495, 972, 1047, 1152, 1652
Tru9I	TTAA	6 cut(s)	348, 495, 972, 1047, 1152, 1652
TscAI	CASTG	2 cut(s)	1237, 1381
TseFI	GTSAC	4 cut(s)	425, 543, 587, 1346
TseI	GCWGC	7 cut(s)	206, 685, 867, 1340, 1436, 1513, 1682
Tsp45I	GTSAC	4 cut(s)	425, 543, 587, 1346
TspDTI	ATGAA	2 cut(s)	380, 1357
TspRI	CASTG	2 cut(s)	1237, 1381
VpaK11BI	GGWCC	2 cut(s)	517, 1485
VspI	ATTAAT	1 cut(s)	348
XapI	RAATTY	3 cut(s)	76, 1088, 1159
XceI	RCATGY	2 cut(s)	554, 1465
XcmI	CCANNNNNNNNNTGG	1 cut(s)	580
XhoI	CTCGAG	1 cut(s)	266
XmiI	GTMKAC	1 cut(s)	1056
XspI	CTAG	4 cut(s)	371, 618, 1268, 1592
ZraI	GACGTC	1 cut(s)	430
Zsp2I	ATGCAT	1 cut(s)	1708

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.