Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0017900.1

Orthogroup ID

OG0001649

Physical Location & Seq

Genomic Coordinates Forward (+)

39210 .. 40689

Gene Structure 1480 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0017900.1_g000011.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1011 bp

atgtacatcgttctaaatggttcaaatttcaaagaagaagttgcgttgcagatttgtgtaaatggtggaaggagaagaaaaagcttatcacagagagtcgaacacaagctggggttggcggttaattctgttactatatatatctctcgtcgccgctgttgctaccctcactctgctaagaaacttcaaccgctacttccattcaagtcaggtgactcaggtctcgggtcgacccggacctctgggaagctgatgaagaaccgggtcgcgtggagaggcgactcggggctccaagatgggagtgaggaggggttggacttatcaaaggggatgtatgatgctggtgatcttttaaagtttgggtttcctatggctttcactgcaacagttttgtcttgggctattcttgaatatggggaccaaatgaaagaggtgaagcaattgggtcatgcccatgactcactgaagtggattactgattacttgatcaatgcacatccttccccaaatgtgctatatatccaggtgggtgatcctgaattagaccacaattgttggcaaagacctgaaaccatgacagagagaaggcctctagttcaaatcaacacatctttcccaggaacagaagtggcagcagaaacagcagcagctatggcatcagcatctcttgttttcaggaaaatcgactcctcatactcaaaatcgctcctcaagcatgccgaccagctgtttaattttgccgatacttatagaggttcttatagtgccagcataccccatgtgcaggggttctacaactcttcaggatatggagatgagctattgtgggcagctacctggctctaccatgcaactggagatctggactacctcaagtatgtgaccgaacagaacgggccaacatttgctaactggggaagtccatcttggtttagttgggatgacaagcatgctgcaactcaagtacatttagttcttaatgtccaatcatgtcaaagtttccctttgtag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko00500 ko01100 map00500 map01100

Pfam Domains

Protein Families

Glyco_hydro_9

Protein Analysis

336

Amino Acids

37.53

Weight (kDa)

7.17

Isoelectric Point (pI)

39.23

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001649)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G19940 AT1G19940 AT1G19940 AT1G75680
fragaria_vesca	FvH4_1g11950 FvH4_1g11950 FvH4_1g11950 FvH4_1g11950 FvH4_1g11950 FvH4_2g38670
malus_domestica	MD08G1014300.v1.1 MD15G1013700.v1.1 MD15G1246400.v1.1
prunus_persica	Prupe.1G367400_v2.0.a1 Prupe.7G167300_v2.0.a1
pyrus_communis	pycom08g01290 pycom15g01190 pycom15g21680
rosa_chinensis	RchiOBHm_Chr2g0099551 RchiOBHm_Chr2g0099561 RchiOBHm_Chr2g0099571 RchiOBHm_Chr6g0302641
rosa_laevigata	RLG00000011152 RLG00000016892
rosa_multiflora	Rmu_co8327967.1_g000001 Rmu_sc0005120.1_g000001 Rmu_sc0005120.1_g000003 Rmu_sc0005455.1_g000004 Rmu_sc0017900.1_g000011
rosa_roxburghii	Rroxscaffold_2G00142970 Rroxscaffold_7G00165480
rosa_rugosa	Rorug02G0080700 Rorug06G0315700
rosa_samantha	Rh2AG130500 Rh2AG130600 Rh2BG133600 Rh2BG133700 Rh2CG134300 Rh2CG134500 Rh2DG134600 Rh2DG134700 Rh2DG134900 Rh6AG429000 Rh6BG473500 Rh6CG441300 Rh6DG428100
rosa_wichuraiana	Rw2G010070 Rw2G010080 Rw6G037130

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccI	GTMKAC	1 cut(s)	230
AccII	CGCG	1 cut(s)	269
AciI	CCGC	3 cut(s)	119, 154, 191
AclWI	GGATC	1 cut(s)	527
AcsI	RAATTY	1 cut(s)	25
AcuI	CTGAAG	2 cut(s)	485, 786
AfaI	GTAC	2 cut(s)	5, 966
AfiI	CCNNNNNNNGG	1 cut(s)	784
AgsI	TTSAA	6 cut(s)	24, 31, 188, 205, 410, 599
AjnI	CCWGG	3 cut(s)	522, 616, 836
AjuI	GAANNNNNNNTTGG	2 cut(s)	910, 942
AleI	CACNNNNGTG	1 cut(s)	466
AluBI	AGCT	7 cut(s)	84, 109, 250, 650, 727, 820, 833
AluI	AGCT	7 cut(s)	84, 109, 250, 650, 727, 820, 833
Alw26I	GTCTC	1 cut(s)	227
AlwI	GGATC	1 cut(s)	527
Ama87I	CYCGRG	2 cut(s)	224, 283
AoxI	GGCC	2 cut(s)	587, 896
ApeKI	GCWGC	5 cut(s)	632, 644, 647, 830, 953
ApoI	RAATTY	1 cut(s)	25
AspS9I	GGNCC	3 cut(s)	237, 418, 896
AsuC2I	CCSGG	2 cut(s)	235, 263
AsuHPI	GGTGA	4 cut(s)	224, 356, 445, 542
AvaI	CYCGRG	2 cut(s)	224, 283
AvaII	GGWCC	2 cut(s)	237, 418
BanII	GRGCYC	1 cut(s)	291
BbvI	GCAGC	5 cut(s)	644, 656, 659, 842, 940
BccI	CCATC	2 cut(s)	290, 931
BciT130I	CCWGG	3 cut(s)	524, 618, 838
BclI	TGATCA	1 cut(s)	486
BcnI	CCSGG	2 cut(s)	235, 263
BcoDI	GTCTC	1 cut(s)	227
BfaI	CTAG	1 cut(s)	593
BglII	AGATCT	1 cut(s)	859
BisI	GCNGC	6 cut(s)	154, 633, 645, 648, 831, 954
BlsI	GCNGC	6 cut(s)	155, 634, 646, 649, 832, 955
Bme1390I	CCNGG	5 cut(s)	235, 263, 524, 618, 838
Bme18I	GGWCC	2 cut(s)	237, 418
BmeT110I	CYCGRG	2 cut(s)	224, 283
BmgT120I	GGNCC	3 cut(s)	237, 418, 896
BmiI	GGNNCC	2 cut(s)	290, 419
BmrFI	CCNGG	5 cut(s)	235, 263, 524, 618, 838
BmrI	ACTGGG	1 cut(s)	922
BmsI	GCATC	3 cut(s)	328, 665, 671
BmuI	ACTGGG	1 cut(s)	922
BoxI	GACNNNNGTC	1 cut(s)	219
BplI	GAGNNNNNCTC	2 cut(s)	574, 606
BpmI	CTGGAG	1 cut(s)	876
BpuEI	CTTGAG	3 cut(s)	695, 857, 945
BpuMI	CCSGG	2 cut(s)	235, 263
BsaI	GGTCTC	1 cut(s)	227
BsaJI	CCNNGG	1 cut(s)	616
Bsc4I	CCNNNNNNNGG	1 cut(s)	784
Bse1I	ACTGG	2 cut(s)	859, 917
BseBI	CCWGG	3 cut(s)	524, 618, 838
BseDI	CCNNGG	1 cut(s)	616
BseGI	GGATG	3 cut(s)	336, 496, 946
BseLI	CCNNNNNNNGG	1 cut(s)	784
BseMII	CTCAG	1 cut(s)	231
BseNI	ACTGG	2 cut(s)	859, 917
BseRI	GAGGAG	3 cut(s)	320, 679, 698
BseXI	GCAGC	5 cut(s)	644, 656, 659, 842, 940
BseYI	CCCAGC	1 cut(s)	109
BsgI	GTGCAG	1 cut(s)	803
Bsh1236I	CGCG	1 cut(s)	269
BshFI	GGCC	2 cut(s)	589, 898
BsiHKCI	CYCGRG	2 cut(s)	224, 283
BsiSI	CCGG	2 cut(s)	235, 262
BslFI	GGGAC	1 cut(s)	431
BslI	CCNNNNNNNGG	1 cut(s)	784
BsmAI	GTCTC	1 cut(s)	227
BsmFI	GGGAC	1 cut(s)	431
BsnI	GGCC	2 cut(s)	589, 898
Bso31I	GGTCTC	1 cut(s)	227
BsoBI	CYCGRG	2 cut(s)	224, 283
Bsp1286I	GDGCHC	1 cut(s)	291
Bsp1407I	TGTACA	1 cut(s)	3
Bsp143I	GATC	4 cut(s)	346, 486, 532, 859
BspACI	CCGC	3 cut(s)	119, 154, 191
BspANI	GGCC	2 cut(s)	589, 898
BspCNI	CTCAG	1 cut(s)	230
BspFNI	CGCG	1 cut(s)	269
BspLI	GGNNCC	2 cut(s)	290, 419
BspPI	GGATC	1 cut(s)	527
BspTNI	GGTCTC	1 cut(s)	227
BsrGI	TGTACA	1 cut(s)	3
BsrI	ACTGG	2 cut(s)	859, 917
BssECI	CCNNGG	1 cut(s)	616
BssMI	GATC	4 cut(s)	346, 486, 532, 859
Bst2UI	CCWGG	3 cut(s)	524, 618, 838
Bst4CI	ACNGT	1 cut(s)	388
Bst6I	CTCTTC	1 cut(s)	805
BstAUI	TGTACA	1 cut(s)	3
BstC8I	GCNNGC	3 cut(s)	717, 769, 951
BstDEI	CTNAG	2 cut(s)	177, 217
BstF5I	GGATG	3 cut(s)	336, 496, 946
BstFNI	CGCG	1 cut(s)	269
BstKTI	GATC	4 cut(s)	349, 489, 535, 862
BstMAI	GTCTC	1 cut(s)	227
BstMBI	GATC	4 cut(s)	346, 486, 532, 859
BstMWI	GCNNNNNNNGC	5 cut(s)	159, 380, 641, 653, 712
BstNI	CCWGG	3 cut(s)	524, 618, 838
BstNSI	RCATGY	2 cut(s)	719, 953
BstPAI	GACNNNNGTC	1 cut(s)	219
BstSCI	CCNGG	5 cut(s)	233, 261, 522, 616, 836
BstUI	CGCG	1 cut(s)	269
BstV1I	GCAGC	5 cut(s)	644, 656, 659, 842, 940
BstX2I	RGATCY	1 cut(s)	859
BstXI	CCANNNNNNTGG	1 cut(s)	854
BstYI	RGATCY	1 cut(s)	859
BsuRI	GGCC	2 cut(s)	589, 898
BtsCI	GGATG	3 cut(s)	336, 496, 946
BtsI	GCAGTG	1 cut(s)	378
BtsIMutI	CAGTG	2 cut(s)	378, 461
Cac8I	GCNNGC	3 cut(s)	717, 769, 951
Cfr13I	GGNCC	3 cut(s)	237, 418, 896
Csp6I	GTAC	2 cut(s)	4, 965
CspCI	CAANNNNNGTGG	2 cut(s)	536, 571
CviAII	CATG	8 cut(s)	449, 455, 574, 716, 779, 848, 950, 990
CviQI	GTAC	2 cut(s)	4, 965
DdeI	CTNAG	2 cut(s)	177, 217
DpnI	GATC	4 cut(s)	348, 488, 534, 861
DpnII	GATC	4 cut(s)	346, 486, 532, 859
DraI	TTTAAA	1 cut(s)	354
Eam1104I	CTCTTC	1 cut(s)	805
EarI	CTCTTC	1 cut(s)	805
Eco147I	AGGCCT	1 cut(s)	589
Eco24I	GRGCYC	1 cut(s)	291
Eco31I	GGTCTC	1 cut(s)	227
Eco47I	GGWCC	2 cut(s)	237, 418
Eco57I	CTGAAG	2 cut(s)	485, 786
Eco88I	CYCGRG	2 cut(s)	224, 283
EcoRII	CCWGG	3 cut(s)	522, 616, 836
EcoT38I	GRGCYC	1 cut(s)	291
FaeI	CATG	8 cut(s)	452, 458, 577, 719, 782, 851, 953, 993
FalI	AAGNNNNNCTT	3 cut(s)	910, 942, 988
FaqI	GGGAC	1 cut(s)	431
FatI	CATG	8 cut(s)	448, 454, 573, 715, 778, 847, 949, 989
FbaI	TGATCA	1 cut(s)	486
FblI	GTMKAC	1 cut(s)	230
Fnu4HI	GCNGC	6 cut(s)	154, 633, 645, 648, 831, 954
FokI	GGATG	3 cut(s)	343, 483, 953
FriOI	GRGCYC	1 cut(s)	291
Fsp4HI	GCNGC	6 cut(s)	154, 633, 645, 648, 831, 954
FspBI	CTAG	1 cut(s)	593
GluI	GCNGC	6 cut(s)	154, 633, 645, 648, 831, 954
GsaI	CCCAGC	1 cut(s)	113
GsuI	CTGGAG	1 cut(s)	876
HaeIII	GGCC	2 cut(s)	589, 898
HapII	CCGG	2 cut(s)	235, 262
Hin1II	CATG	8 cut(s)	452, 458, 577, 719, 782, 851, 953, 993
HincII	GTYRAC	1 cut(s)	231
HindII	GTYRAC	1 cut(s)	231
HindIII	AAGCTT	1 cut(s)	82
HinfI	GANTC	5 cut(s)	96, 215, 281, 458, 686
HpaII	CCGG	2 cut(s)	235, 262
HphI	GGTGA	4 cut(s)	224, 356, 445, 542
Hpy166II	GTNNAC	1 cut(s)	231
Hpy188III	TCNNGA	5 cut(s)	407, 536, 676, 804, 863
Hpy8I	GTNNAC	1 cut(s)	231
Hpy99I	CGWCG	1 cut(s)	153
HpyAV	CCTTC	3 cut(s)	63, 510, 579
HpyCH4III	ACNGT	1 cut(s)	388
HpyCH4V	TGCA	6 cut(s)	49, 383, 494, 784, 851, 956
HpyF10VI	GCNNNNNNNGC	5 cut(s)	159, 380, 641, 653, 712
HpyF3I	CTNAG	2 cut(s)	177, 217
Hsp92II	CATG	8 cut(s)	452, 458, 577, 719, 782, 851, 953, 993
Ksp22I	TGATCA	1 cut(s)	486
Kzo9I	GATC	4 cut(s)	346, 486, 532, 859
LmnI	GCTCC	2 cut(s)	294, 711
Lsp1109I	GCAGC	5 cut(s)	644, 656, 659, 842, 940
LweI	GCATC	3 cut(s)	328, 665, 671
MaeI	CTAG	1 cut(s)	593
MaeIII	GTNAC	3 cut(s)	130, 212, 880
MalI	GATC	4 cut(s)	348, 488, 534, 861
MboI	GATC	4 cut(s)	346, 486, 532, 859
MboII	GAAGA	4 cut(s)	47, 87, 268, 792
MfeI	CAATTG	2 cut(s)	440, 550
MflI	RGATCY	1 cut(s)	859
MhlI	GDGCHC	1 cut(s)	291
MluCI	AATT	6 cut(s)	25, 124, 440, 539, 550, 733
MlyI	GAGTC	5 cut(s)	105, 209, 275, 452, 680
MmeI	TCCRAC	1 cut(s)	294
MseI	TTAA	4 cut(s)	123, 353, 732, 978
MslI	CAYNNNNRTG	2 cut(s)	453, 466
MspA1I	CMGCKG	2 cut(s)	156, 727
MspI	CCGG	2 cut(s)	235, 262
MspR9I	CCNGG	5 cut(s)	235, 263, 524, 618, 838
MunI	CAATTG	2 cut(s)	440, 550
MvaI	CCWGG	3 cut(s)	524, 618, 838
MvnI	CGCG	1 cut(s)	269
MwoI	GCNNNNNNNGC	5 cut(s)	159, 380, 641, 653, 712
NciI	CCSGG	2 cut(s)	235, 263
NdeII	GATC	4 cut(s)	346, 486, 532, 859
NlaIII	CATG	8 cut(s)	452, 458, 577, 719, 782, 851, 953, 993
NlaIV	GGNNCC	2 cut(s)	290, 419
NmuCI	GTSAC	2 cut(s)	212, 880
NspI	RCATGY	2 cut(s)	719, 953
OliI	CACNNNNGTG	1 cut(s)	466
PaeI	GCATGC	2 cut(s)	719, 953
PceI	AGGCCT	1 cut(s)	589
PkrI	GCNGC	6 cut(s)	155, 634, 646, 649, 832, 955
PleI	GAGTC	5 cut(s)	104, 209, 275, 452, 680
PpsI	GAGTC	5 cut(s)	104, 209, 275, 452, 680
PshAI	GACNNNNGTC	1 cut(s)	219
Psp6I	CCWGG	3 cut(s)	522, 616, 836
PspFI	CCCAGC	1 cut(s)	109
PspGI	CCWGG	3 cut(s)	522, 616, 836
PspN4I	GGNNCC	2 cut(s)	290, 419
PspPI	GGNCC	3 cut(s)	237, 418, 896
PsrI	GAACNNNNNNTAC	2 cut(s)	957, 989
PsuI	RGATCY	1 cut(s)	859
PvuII	CAGCTG	1 cut(s)	727
RsaI	GTAC	2 cut(s)	5, 966
RsaNI	GTAC	2 cut(s)	4, 965
RseI	CAYNNNNRTG	2 cut(s)	453, 466
SalI	GTCGAC	1 cut(s)	229
SaqAI	TTAA	4 cut(s)	123, 353, 732, 978
SatI	GCNGC	6 cut(s)	154, 633, 645, 648, 831, 954
Sau3AI	GATC	4 cut(s)	346, 486, 532, 859
Sau96I	GGNCC	3 cut(s)	237, 418, 896
SchI	GAGTC	5 cut(s)	105, 209, 275, 452, 680
ScrFI	CCNGG	5 cut(s)	235, 263, 524, 618, 838
SduI	GDGCHC	1 cut(s)	291
SfaNI	GCATC	3 cut(s)	328, 665, 671
SinI	GGWCC	2 cut(s)	237, 418
SmiMI	CAYNNNNRTG	2 cut(s)	453, 466
SmlI	CTYRAG	3 cut(s)	710, 872, 960
SmoI	CTYRAG	3 cut(s)	710, 872, 960
SphI	GCATGC	2 cut(s)	719, 953
Sse9I	AATT	6 cut(s)	25, 124, 440, 539, 550, 733
SseBI	AGGCCT	1 cut(s)	589
SsiI	CCGC	3 cut(s)	119, 154, 191
SspMI	CTAG	1 cut(s)	593
StuI	AGGCCT	1 cut(s)	589
StyD4I	CCNGG	5 cut(s)	233, 261, 522, 616, 836
TaaI	ACNGT	1 cut(s)	388
TaqI	TCGA	3 cut(s)	99, 230, 684
TaqII	GACCGA	1 cut(s)	899
TasI	AATT	6 cut(s)	25, 124, 440, 539, 550, 733
TatI	WGTACW	2 cut(s)	3, 964
TauI	GCSGC	1 cut(s)	156
Tru1I	TTAA	4 cut(s)	123, 353, 732, 978
Tru9I	TTAA	4 cut(s)	123, 353, 732, 978
TscAI	CASTG	2 cut(s)	385, 468
TseFI	GTSAC	2 cut(s)	212, 880
TseI	GCWGC	5 cut(s)	632, 644, 647, 830, 953
Tsp45I	GTSAC	2 cut(s)	212, 880
TspDTI	ATGAA	2 cut(s)	269, 440
TspRI	CASTG	2 cut(s)	385, 468
VpaK11BI	GGWCC	2 cut(s)	237, 418
XapI	RAATTY	1 cut(s)	25
XceI	RCATGY	2 cut(s)	719, 953
XmiI	GTMKAC	1 cut(s)	230
XspI	CTAG	1 cut(s)	593

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.