Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0019031.1

Orthogroup ID

OG0006034

Physical Location & Seq

Genomic Coordinates Reverse (-)

2 .. 467

Gene Structure 466 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0019031.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 466 bp

atgtggcttagagacccattcccacaattcttcccagatgcagacttccaaattgcatgtgactacttccgaggcgattcttacgatgtgaacaaccttccgaacggaggatttacctatgtagtctctaataaacggaccacccaattctacaacttttggtacttctcaaggcaggcgtatccgaataatcacgaccaggacgtgctcaacaagatcaaatctgatccgttcatcaccagcatcggattgaaaatgagattcttggacaccaaatactttggcggcttctgtcagcccagtaaagatttaaacctggtttgcacaatgcacgctaattgctgtgttggtctcgataacaaagtcaatgacctcaaaattctgcttcaagattggagaaattacgtggcattgcctccttctccttcttcatcttcttccggtcctacttctaataccaccacgc

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Nucleotid_trans

Protein Analysis

155

Amino Acids

17.79

Weight (kDa)

6.69

Isoelectric Point (pI)

57.27

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0006034)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT4G19975 AT5G44820
fragaria_vesca	FvH4_5g18190 FvH4_5g18190 FvH4_5g18190
malus_domestica	MD06G1237300.v1.1 MD06G1237400.v1.1 MD06G1237600.v1.1 MD14G1244100.v1.1 MD14G1244200.v1.1
prunus_persica	Prupe.5G241800_v2.0.a1
pyrus_communis	pycom06g21290 pycom06g21330 pycom14g20530
rosa_chinensis	RchiOBHm_Chr7g0177411
rosa_laevigata	RLG00000005539
rosa_multiflora	Rmu_sc0005310.1_g000002 Rmu_sc0005545.1_g000003 Rmu_sc0019030.1_g000001 Rmu_sc0019031.1_g000001
rosa_roxburghii	Rroxscaffold_3G00275890
rosa_rugosa	Rorug06G0405600
rosa_samantha	Rh7AG005300 Rh7BG005300 Rh7CG005400 Rh7DG005100
rosa_wichuraiana	Rw7G000440

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	285
AclWI	GGATC	1 cut(s)	221
AcsI	RAATTY	1 cut(s)	378
AfaI	GTAC	1 cut(s)	164
AfiI	CCNNNNNNNGG	1 cut(s)	107
AgsI	TTSAA	2 cut(s)	253, 389
AjiI	CACGTC	1 cut(s)	205
AjnI	CCWGG	2 cut(s)	198, 315
Alw21I	GWGCWC	1 cut(s)	210
Alw26I	GTCTC	3 cut(s)	6, 130, 356
AlwI	GGATC	1 cut(s)	221
ApoI	RAATTY	1 cut(s)	378
AspS9I	GGNCC	2 cut(s)	138, 443
AsuHPI	GGTGA	1 cut(s)	229
AvaII	GGWCC	2 cut(s)	138, 443
Bbv12I	GWGCWC	1 cut(s)	210
BciT130I	CCWGG	2 cut(s)	200, 317
BciVI	GTATCC	1 cut(s)	192
BcoDI	GTCTC	3 cut(s)	6, 130, 356
BfuI	GTATCC	1 cut(s)	192
BisI	GCNGC	1 cut(s)	286
BlsI	GCNGC	1 cut(s)	287
Bme1390I	CCNGG	2 cut(s)	200, 317
Bme18I	GGWCC	2 cut(s)	138, 443
BmgBI	CACGTC	1 cut(s)	205
BmgT120I	GGNCC	2 cut(s)	138, 443
BmrFI	CCNGG	2 cut(s)	200, 317
BmrI	ACTGGG	1 cut(s)	294
BmsI	GCATC	2 cut(s)	28, 252
BmuI	ACTGGG	1 cut(s)	294
BpuEI	CTTGAG	1 cut(s)	154
BsaAI	YACGTR	1 cut(s)	406
BsaI	GGTCTC	2 cut(s)	6, 356
BsaJI	CCNNGG	1 cut(s)	70
BsaWI	WCCGGW	1 cut(s)	440
Bsc4I	CCNNNNNNNGG	1 cut(s)	107
Bse1I	ACTGG	1 cut(s)	300
Bse3DI	GCAATG	1 cut(s)	410
BseBI	CCWGG	2 cut(s)	200, 317
BseDI	CCNNGG	1 cut(s)	70
BseLI	CCNNNNNNNGG	1 cut(s)	107
BseMI	GCAATG	1 cut(s)	410
BseNI	ACTGG	1 cut(s)	300
BsiHKAI	GWGCWC	1 cut(s)	210
BsiSI	CCGG	1 cut(s)	441
BslI	CCNNNNNNNGG	1 cut(s)	107
BsmAI	GTCTC	3 cut(s)	6, 130, 356
Bso31I	GGTCTC	2 cut(s)	6, 356
Bsp1286I	GDGCHC	1 cut(s)	210
Bsp143I	GATC	2 cut(s)	216, 226
BspACI	CCGC	1 cut(s)	285
BspPI	GGATC	1 cut(s)	221
BspTNI	GGTCTC	2 cut(s)	6, 356
BsrDI	GCAATG	1 cut(s)	410
BsrI	ACTGG	1 cut(s)	300
BssECI	CCNNGG	1 cut(s)	70
BssMI	GATC	2 cut(s)	216, 226
Bst2UI	CCWGG	2 cut(s)	200, 317
BstBAI	YACGTR	1 cut(s)	406
BstC8I	GCNNGC	2 cut(s)	177, 333
BstDEI	CTNAG	1 cut(s)	8
BstKTI	GATC	2 cut(s)	219, 229
BstMAI	GTCTC	3 cut(s)	6, 130, 356
BstMBI	GATC	2 cut(s)	216, 226
BstNI	CCWGG	2 cut(s)	200, 317
BstNSI	RCATGY	1 cut(s)	60
BstSCI	CCNGG	2 cut(s)	198, 315
BsuI	GTATCC	1 cut(s)	192
BtrI	CACGTC	1 cut(s)	205
Cac8I	GCNNGC	2 cut(s)	177, 333
Cfr13I	GGNCC	2 cut(s)	138, 443
CsiI	ACCWGGT	1 cut(s)	315
Csp6I	GTAC	1 cut(s)	163
CviAII	CATG	1 cut(s)	57
CviJI	RGCY	3 cut(s)	7, 288, 298
CviKI_1	RGCY	3 cut(s)	7, 288, 298
CviQI	GTAC	1 cut(s)	163
DdeI	CTNAG	1 cut(s)	8
DpnI	GATC	2 cut(s)	218, 228
DpnII	GATC	2 cut(s)	216, 226
DraI	TTTAAA	1 cut(s)	312
Eco31I	GGTCTC	2 cut(s)	6, 356
Eco47I	GGWCC	2 cut(s)	138, 443
EcoRII	CCWGG	2 cut(s)	198, 315
FaeI	CATG	1 cut(s)	60
FaiI	YATR	2 cut(s)	58, 120
FatI	CATG	1 cut(s)	56
Fnu4HI	GCNGC	1 cut(s)	286
Fsp4HI	GCNGC	1 cut(s)	286
GluI	GCNGC	1 cut(s)	286
HapII	CCGG	1 cut(s)	441
Hin1II	CATG	1 cut(s)	60
HinfI	GANTC	2 cut(s)	77, 261
HpaII	CCGG	1 cut(s)	441
HphI	GGTGA	1 cut(s)	229
Hpy166II	GTNNAC	1 cut(s)	91
Hpy188I	TCNGA	5 cut(s)	71, 102, 186, 226, 248
Hpy188III	TCNNGA	3 cut(s)	194, 353, 389
Hpy8I	GTNNAC	1 cut(s)	91
HpyAV	CCTTC	3 cut(s)	107, 429, 435
HpyCH4IV	ACGT	2 cut(s)	204, 405
HpyCH4V	TGCA	4 cut(s)	41, 56, 324, 331
HpyF3I	CTNAG	1 cut(s)	8
HpySE526I	ACGT	2 cut(s)	204, 405
Hsp92II	CATG	1 cut(s)	60
Kzo9I	GATC	2 cut(s)	216, 226
LpnPI	CCDG	9 cut(s)	48, 161, 185, 212, 253, 302, 313, 329, 454
LweI	GCATC	2 cut(s)	28, 252
MabI	ACCWGGT	1 cut(s)	315
MaeII	ACGT	2 cut(s)	204, 405
MaeIII	GTNAC	1 cut(s)	59
MalI	GATC	2 cut(s)	218, 228
MboI	GATC	2 cut(s)	216, 226
MboII	GAAGA	4 cut(s)	22, 420, 426, 429
MhlI	GDGCHC	1 cut(s)	210
MluCI	AATT	6 cut(s)	26, 51, 146, 337, 378, 400
MnlI	CCTC	4 cut(s)	65, 101, 383, 426
MseI	TTAA	1 cut(s)	311
MspI	CCGG	1 cut(s)	441
MspR9I	CCNGG	2 cut(s)	200, 317
MvaI	CCWGG	2 cut(s)	200, 317
NdeII	GATC	2 cut(s)	216, 226
NlaIII	CATG	1 cut(s)	60
NmuCI	GTSAC	1 cut(s)	59
NspI	RCATGY	1 cut(s)	60
PcsI	WCGNNNNNNNCGW	1 cut(s)	201
PfeI	GAWTC	2 cut(s)	77, 261
PkrI	GCNGC	1 cut(s)	287
Ppu21I	YACGTR	1 cut(s)	406
Psp6I	CCWGG	2 cut(s)	198, 315
PspGI	CCWGG	2 cut(s)	198, 315
PspPI	GGNCC	2 cut(s)	138, 443
RsaI	GTAC	1 cut(s)	164
RsaNI	GTAC	1 cut(s)	163
SaqAI	TTAA	1 cut(s)	311
SatI	GCNGC	1 cut(s)	286
Sau3AI	GATC	2 cut(s)	216, 226
Sau96I	GGNCC	2 cut(s)	138, 443
ScrFI	CCNGG	2 cut(s)	200, 317
SduI	GDGCHC	1 cut(s)	210
SetI	ASST	6 cut(s)	99, 119, 207, 318, 375, 408
SexAI	ACCWGGT	1 cut(s)	315
SfaNI	GCATC	2 cut(s)	28, 252
SinI	GGWCC	2 cut(s)	138, 443
SmlI	CTYRAG	1 cut(s)	169
SmoI	CTYRAG	1 cut(s)	169
Sse9I	AATT	6 cut(s)	26, 51, 146, 337, 378, 400
SsiI	CCGC	1 cut(s)	285
StyD4I	CCNGG	2 cut(s)	198, 315
TaiI	ACGT	2 cut(s)	207, 408
TaqI	TCGA	1 cut(s)	354
TasI	AATT	6 cut(s)	26, 51, 146, 337, 378, 400
TauI	GCSGC	1 cut(s)	288
TfiI	GAWTC	2 cut(s)	77, 261
Tru1I	TTAA	1 cut(s)	311
Tru9I	TTAA	1 cut(s)	311
TseFI	GTSAC	1 cut(s)	59
Tsp45I	GTSAC	1 cut(s)	59
TspDTI	ATGAA	2 cut(s)	223, 420
TspGWI	ACGGA	3 cut(s)	120, 151, 219
VpaK11BI	GGWCC	2 cut(s)	138, 443
XapI	RAATTY	1 cut(s)	378
XceI	RCATGY	1 cut(s)	60

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.