Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0021015.1

Orthogroup ID

OG0003301

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 594

Gene Structure 594 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0021015.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 594 bp

aagcaggctgcgcaaggggggaatattggtggcctgtatgcactgttacaggaggactcatatatattggagcgcatcaaccttgttccatttgttgatactcctttgcacattgctgcatcttcagggcataccgattttgccatggagatgatgagattgaagccagaatttgcaaggaagcaaaacccggaaggcttcagcgcaatgcaccttgctttgaagcaaggaaaaacacatacattgctttttctcctgtccgtctatagggaccttgtccgagtcaaaggaagggagggaaagactctcttgcattatgcagccgaaattggaaacttagatcttttggctgagtttttagcagcttccccagagtctatcatagatctgacaattcgaaaagaaactgcacttcatgttgctgcaaagaatgacaagttggaagcacttgaagtcttgatgggatggcttcaccatgttgatatggacatgatcttgcagaggactgatgatgaaggcaacactgtactgcacattgcaatattaagaaatcaattccaggcaagcttttcttccctcagtacttatccctaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Ank Ank_2 Ank_4 Ank_5 PGG

Protein Analysis

197

Amino Acids

22.0

Weight (kDa)

5.98

Isoelectric Point (pI)

41.05

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003301)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G14480 AT1G14480 AT1G14500 AT4G10720 AT4G10720 AT5G15500 AT5G15500 AT5G54610 AT5G54620
fragaria_vesca	FvH4_7g26700
malus_domestica	MD04G1235200.v1.1
prunus_persica	Prupe.5G057700_v2.0.a1
rosa_chinensis	RchiOBHm_Chr1g0373291 RchiOBHm_Chr7g0205421
rosa_laevigata	RLG00000003382 RLG00000026829
rosa_multiflora	Rmu_sc0000170.1_g000001 Rmu_sc0006687.1_g000001 Rmu_sc0021015.1_g000001
rosa_roxburghii	Rroxscaffold_3G00252390 Rroxscaffold_4G00284290
rosa_rugosa	Rorug01G0376900 Rorug07G0091300
rosa_samantha	Rh1AG385800 Rh1AG386000 Rh1BG350000 Rh1DG380800 Rh1DG381000 Rh7AG221300 Rh7BG217400 Rh7CG234200 Rh7CG234300 Rh7DG228100
rosa_wichuraiana	Rw1G034910 Rw7G019110 Rw7G019120

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc16I	TGCGCA	1 cut(s)	12
AcsI	RAATTY	1 cut(s)	170
AcuI	CTGAAG	2 cut(s)	108, 184
AfaI	GTAC	2 cut(s)	528, 583
AfiI	CCNNNNNNNGG	1 cut(s)	267
AgsI	TTSAA	3 cut(s)	163, 223, 452
AjnI	CCWGG	1 cut(s)	558
AjuI	GAANNNNNNNTTGG	2 cut(s)	422, 454
AluBI	AGCT	2 cut(s)	365, 567
AluI	AGCT	2 cut(s)	365, 567
AoxI	GGCC	1 cut(s)	31
ApeKI	GCWGC	5 cut(s)	8, 116, 320, 362, 422
ApoI	RAATTY	1 cut(s)	170
AspLEI	GCGC	3 cut(s)	13, 75, 206
AspS9I	GGNCC	1 cut(s)	271
AsuC2I	CCSGG	1 cut(s)	191
AsuHPI	GGTGA	1 cut(s)	464
AsuII	TTCGAA	1 cut(s)	397
AvaII	GGWCC	1 cut(s)	271
BbvI	GCAGC	4 cut(s)	103, 332, 374, 409
BccI	CCATC	2 cut(s)	454, 459
BciT130I	CCWGG	1 cut(s)	560
BcnI	CCSGG	1 cut(s)	191
BfmI	CTRYAG	1 cut(s)	265
BglII	AGATCT	2 cut(s)	340, 385
BisI	GCNGC	5 cut(s)	9, 117, 321, 363, 423
BlsI	GCNGC	5 cut(s)	10, 118, 322, 364, 424
BmcAI	AGTACT	1 cut(s)	583
Bme1390I	CCNGG	2 cut(s)	191, 560
Bme18I	GGWCC	1 cut(s)	271
BmgT120I	GGNCC	1 cut(s)	271
BmiI	GGNNCC	1 cut(s)	272
BmrFI	CCNGG	2 cut(s)	191, 560
BmsI	GCATC	2 cut(s)	84, 128
Bpu14I	TTCGAA	1 cut(s)	397
BpuMI	CCSGG	1 cut(s)	191
BsaJI	CCNNGG	1 cut(s)	144
Bsc4I	CCNNNNNNNGG	1 cut(s)	267
Bse3DI	GCAATG	4 cut(s)	111, 213, 242, 534
BseBI	CCWGG	1 cut(s)	560
BseDI	CCNNGG	1 cut(s)	144
BseGI	GGATG	1 cut(s)	470
BseLI	CCNNNNNNNGG	1 cut(s)	267
BseMI	GCAATG	4 cut(s)	111, 213, 242, 534
BseMII	CTCAG	2 cut(s)	342, 592
BseXI	GCAGC	4 cut(s)	103, 332, 374, 409
BsgI	GTGCAG	2 cut(s)	393, 515
BshFI	GGCC	1 cut(s)	33
BsiSI	CCGG	1 cut(s)	191
BslFI	GGGAC	1 cut(s)	284
BslI	CCNNNNNNNGG	1 cut(s)	267
BsmFI	GGGAC	1 cut(s)	284
BsnI	GGCC	1 cut(s)	33
Bsp119I	TTCGAA	1 cut(s)	397
Bsp143I	GATC	3 cut(s)	340, 385, 492
Bsp19I	CCATGG	1 cut(s)	144
BspANI	GGCC	1 cut(s)	33
BspCNI	CTCAG	2 cut(s)	343, 591
BspLI	GGNNCC	1 cut(s)	272
BspT104I	TTCGAA	1 cut(s)	397
BsrDI	GCAATG	4 cut(s)	111, 213, 242, 534
BssECI	CCNNGG	1 cut(s)	144
BssMI	GATC	3 cut(s)	340, 385, 492
BssT1I	CCWWGG	1 cut(s)	144
Bst2UI	CCWGG	1 cut(s)	560
Bst4CI	ACNGT	2 cut(s)	45, 526
BstBI	TTCGAA	1 cut(s)	397
BstC8I	GCNNGC	2 cut(s)	6, 565
BstDEI	CTNAG	3 cut(s)	337, 351, 578
BstDSI	CCRYGG	1 cut(s)	144
BstF5I	GGATG	1 cut(s)	470
BstHHI	GCGC	3 cut(s)	13, 75, 206
BstKTI	GATC	3 cut(s)	343, 388, 495
BstMBI	GATC	3 cut(s)	340, 385, 492
BstMWI	GCNNNNNNNGC	1 cut(s)	10
BstNI	CCWGG	1 cut(s)	560
BstSCI	CCNGG	2 cut(s)	189, 558
BstSFI	CTRYAG	1 cut(s)	265
BstV1I	GCAGC	4 cut(s)	103, 332, 374, 409
BstX2I	RGATCY	2 cut(s)	340, 385
BstYI	RGATCY	2 cut(s)	340, 385
BsuRI	GGCC	1 cut(s)	33
BtgI	CCRYGG	1 cut(s)	144
BtsCI	GGATG	1 cut(s)	470
BtsIMutI	CAGTG	2 cut(s)	41, 522
Cac8I	GCNNGC	2 cut(s)	6, 565
CfoI	GCGC	3 cut(s)	13, 75, 206
Cfr13I	GGNCC	1 cut(s)	271
Csp6I	GTAC	2 cut(s)	527, 582
CviAII	CATG	4 cut(s)	145, 416, 476, 490
CviJI	RGCY	9 cut(s)	8, 33, 166, 198, 323, 350, 365, 469, 567
CviKI_1	RGCY	9 cut(s)	8, 33, 166, 198, 323, 350, 365, 469, 567
CviQI	GTAC	2 cut(s)	527, 582
DdeI	CTNAG	3 cut(s)	337, 351, 578
DpnI	GATC	3 cut(s)	342, 387, 494
DpnII	GATC	3 cut(s)	340, 385, 492
Eco130I	CCWWGG	1 cut(s)	144
Eco47I	GGWCC	1 cut(s)	271
Eco57I	CTGAAG	2 cut(s)	108, 184
EcoO109I	RGGNCCY	1 cut(s)	271
EcoRII	CCWGG	1 cut(s)	558
EcoT14I	CCWWGG	1 cut(s)	144
ErhI	CCWWGG	1 cut(s)	144
FaeI	CATG	4 cut(s)	148, 419, 479, 493
FalI	AAGNNNNNCTT	4 cut(s)	293, 325, 556, 588
FaqI	GGGAC	1 cut(s)	284
FatI	CATG	4 cut(s)	144, 415, 475, 489
Fnu4HI	GCNGC	5 cut(s)	9, 117, 321, 363, 423
FokI	GGATG	1 cut(s)	477
Fsp4HI	GCNGC	5 cut(s)	9, 117, 321, 363, 423
FspI	TGCGCA	1 cut(s)	12
GlaI	GCGC	3 cut(s)	12, 74, 205
GluI	GCNGC	5 cut(s)	9, 117, 321, 363, 423
HaeIII	GGCC	1 cut(s)	33
HapII	CCGG	1 cut(s)	191
HhaI	GCGC	3 cut(s)	13, 75, 206
Hin1II	CATG	4 cut(s)	148, 419, 479, 493
Hin6I	GCGC	3 cut(s)	11, 73, 204
HinP1I	GCGC	3 cut(s)	11, 73, 204
HindIII	AAGCTT	1 cut(s)	565
HinfI	GANTC	4 cut(s)	56, 282, 304, 374
HpaII	CCGG	1 cut(s)	191
HphI	GGTGA	1 cut(s)	464
Hpy188I	TCNGA	2 cut(s)	281, 390
Hpy188III	TCNNGA	1 cut(s)	457
HpyAV	CCTTC	3 cut(s)	188, 285, 509
HpyCH4III	ACNGT	2 cut(s)	45, 526
HpyF10VI	GCNNNNNNNGC	1 cut(s)	10
HpyF3I	CTNAG	3 cut(s)	337, 351, 578
Hsp92II	CATG	4 cut(s)	148, 419, 479, 493
HspAI	GCGC	3 cut(s)	11, 73, 204
Kzo9I	GATC	3 cut(s)	340, 385, 492
LmnI	GCTCC	1 cut(s)	70
LpnPI	CCDG	9 cut(s)	35, 47, 111, 180, 204, 269, 384, 545, 572
Lsp1109I	GCAGC	4 cut(s)	103, 332, 374, 409
LweI	GCATC	2 cut(s)	84, 128
MaeIII	GTNAC	1 cut(s)	45
MalI	GATC	3 cut(s)	342, 387, 494
MboI	GATC	3 cut(s)	340, 385, 492
MboII	GAAGA	2 cut(s)	114, 564
MflI	RGATCY	2 cut(s)	340, 385
MluCI	AATT	4 cut(s)	170, 327, 393, 554
MlyI	GAGTC	4 cut(s)	50, 291, 298, 383
MmeI	TCCRAC	1 cut(s)	420
MnlI	CCTC	4 cut(s)	46, 289, 495, 587
MseI	TTAA	1 cut(s)	545
MslI	CAYNNNNRTG	1 cut(s)	149
MspI	CCGG	1 cut(s)	191
MspR9I	CCNGG	2 cut(s)	191, 560
MvaI	CCWGG	1 cut(s)	560
MwoI	GCNNNNNNNGC	1 cut(s)	10
NciI	CCSGG	1 cut(s)	191
NcoI	CCATGG	1 cut(s)	144
NdeII	GATC	3 cut(s)	340, 385, 492
NlaIII	CATG	4 cut(s)	148, 419, 479, 493
NlaIV	GGNNCC	1 cut(s)	272
NsbI	TGCGCA	1 cut(s)	12
NspV	TTCGAA	1 cut(s)	397
PflFI	GACNNNGTC	1 cut(s)	275
PkrI	GCNGC	5 cut(s)	10, 118, 322, 364, 424
PleI	GAGTC	4 cut(s)	50, 290, 298, 382
PpsI	GAGTC	4 cut(s)	50, 290, 298, 382
PpuMI	RGGWCCY	1 cut(s)	271
Psp5II	RGGWCCY	1 cut(s)	271
Psp6I	CCWGG	1 cut(s)	558
PspGI	CCWGG	1 cut(s)	558
PspN4I	GGNNCC	1 cut(s)	272
PspPI	GGNCC	1 cut(s)	271
PspPPI	RGGWCCY	1 cut(s)	271
PsuI	RGATCY	2 cut(s)	340, 385
PsyI	GACNNNGTC	1 cut(s)	275
RsaI	GTAC	2 cut(s)	528, 583
RsaNI	GTAC	2 cut(s)	527, 582
RseI	CAYNNNNRTG	1 cut(s)	149
SaqAI	TTAA	1 cut(s)	545
SatI	GCNGC	5 cut(s)	9, 117, 321, 363, 423
Sau3AI	GATC	3 cut(s)	340, 385, 492
Sau96I	GGNCC	1 cut(s)	271
ScaI	AGTACT	1 cut(s)	583
SchI	GAGTC	4 cut(s)	50, 291, 298, 383
ScrFI	CCNGG	2 cut(s)	191, 560
SetI	ASST	5 cut(s)	84, 216, 276, 367, 569
SfaNI	GCATC	2 cut(s)	84, 128
SfcI	CTRYAG	1 cut(s)	265
SfuI	TTCGAA	1 cut(s)	397
SinI	GGWCC	1 cut(s)	271
SmiMI	CAYNNNNRTG	1 cut(s)	149
Sse9I	AATT	4 cut(s)	170, 327, 393, 554
SspI	AATATT	2 cut(s)	25, 543
StyD4I	CCNGG	2 cut(s)	189, 558
StyI	CCWWGG	1 cut(s)	144
TaaI	ACNGT	2 cut(s)	45, 526
TaqI	TCGA	1 cut(s)	397
TasI	AATT	4 cut(s)	170, 327, 393, 554
TatI	WGTACW	2 cut(s)	526, 581
Tru1I	TTAA	1 cut(s)	545
Tru9I	TTAA	1 cut(s)	545
TscAI	CASTG	2 cut(s)	48, 529
TseI	GCWGC	5 cut(s)	8, 116, 320, 362, 422
TspDTI	ATGAA	2 cut(s)	404, 528
TspGWI	ACGGA	1 cut(s)	250
TspRI	CASTG	2 cut(s)	48, 529
Tth111I	GACNNNGTC	1 cut(s)	275
VpaK11BI	GGWCC	1 cut(s)	271
XapI	RAATTY	1 cut(s)	170
ZrmI	AGTACT	1 cut(s)	583

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.