Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0028569.1

Orthogroup ID

OG0006955

Physical Location & Seq

Genomic Coordinates Forward (+)

1020 .. 2152

Gene Structure 1133 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0028569.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 783 bp

atggagaggatgcgtcgagaaggaatagccaatgatgatgagatatggacaaccgaaatggacattagggaaggttcacaagaaattggttctatgatgcgagccattggtttagacggtttgacctcagagagatatatgcatggaacacaaaaggcaaagaaagatccccctgctgatgaaattttgtatctaatgaaaaccaatggagcacttcaaattgcctatgttgaggaggtttcaactggcagggatgagaaggaatattattctgttcttgtcaagtatgataatcaattagagaaacaaatggaaatctatcgcattaagttacctagtcctttgaagctcggaaagggcaaaccagagaatcaaaatcatgccattatcttcactcgtggtgatgcgggagcatgtcttgaaatggaaatctatcgcattaagttacctagtcctttgaagctcggagagggcaaaccggagaatcaaaatcatgccattatcttcactcgtggtgatgcggttcagatcattgatatgaaccaagacaattattttgaggaggcactcaaaatgaggaatctattagaagaatacaggcactatcatggtatccggaagcttacgatcttgggagttagggagcatgtctttactggttctgtttcacacttgcttggtttatgtcaggtcaggaaacaagttgtcatcttaggacagcaggtgttggtaaatcctttgcaagttcgaatgcattatggtcatccagatgtctttgattga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000003 GO:0001101 GO:0002218 GO:0002253 GO:0002376 GO:0002682 GO:0002684 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005794 GO:0005886 GO:0005911 GO:0006950 GO:0006952 GO:0007154 GO:0007165 GO:0007275 GO:0007568 GO:0008150 GO:0009506 GO:0009555 GO:0009605 GO:0009607 GO:0009617 GO:0009620 GO:0009653 GO:0009719 GO:0009725 GO:0009751 GO:0009863 GO:0009870 GO:0009965 GO:0009987 GO:0010016 GO:0010033 GO:0010150 GO:0012505 GO:0014070 GO:0016020 GO:0016043 GO:0023052 GO:0030054 GO:0031347 GO:0031349 GO:0032501 GO:0032502 GO:0032870 GO:0033036 GO:0033037 GO:0033554 GO:0035690 GO:0042221 GO:0042493 GO:0042545 GO:0042742 GO:0043207 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044444 GO:0044464 GO:0045088 GO:0045089 GO:0045229 GO:0046677 GO:0048229 GO:0048366 GO:0048367 GO:0048518 GO:0048583 GO:0048584 GO:0048731 GO:0048827 GO:0048856 GO:0050776 GO:0050778 GO:0050789 GO:0050794 GO:0050832 GO:0050896 GO:0051179 GO:0051641 GO:0051704 GO:0051707 GO:0051716 GO:0052386 GO:0052482 GO:0052542 GO:0052543 GO:0052544 GO:0052545 GO:0055044 GO:0065007 GO:0070727 GO:0070887 GO:0071229 GO:0071236 GO:0071310 GO:0071407 GO:0071446 GO:0071495 GO:0071554 GO:0071555 GO:0071840 GO:0071944 GO:0080134 GO:0090693 GO:0098542 GO:0099402 GO:1901700 GO:1901701 GO:1905392

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

FKS1_dom1 Glucan_synthase

Protein Analysis

260

Amino Acids

29.9

Weight (kDa)

6.17

Isoelectric Point (pI)

37.9

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0006955)

Species	Orthologous Gene IDs
malus_domestica	MD07G1002000.v1.1 MD09G1150200.v1.1
pyrus_communis	pycom01g02050 pycom01g02060 pycom09g06990 pycom09g07000 pycom09g07010 pycom09g16470 pycom17g13090
rosa_chinensis	RchiOBHm_Chr1g0313351 RchiOBHm_Chr5g0048951 RchiOBHm_Chr7g0233651
rosa_laevigata	RLG00000020576 RLG00000020577
rosa_multiflora	Rmu_sc0002867.1_g000023 Rmu_sc0016396.1_g000003 Rmu_sc0028569.1_g000001
rosa_roxburghii	Rroxscaffold_2G00078910 Rroxscaffold_2G00078920
rosa_samantha	Rh4BG039900 Rh4BG040000 Rh5BG331800 Rh5CG435600 Rh5DG343600 Rh7CG428300
rosa_wichuraiana	Rw5G049220

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AarI	CACCTGC	1 cut(s)	712
Acc36I	ACCTGC	1 cut(s)	712
AccIII	TCCGGA	1 cut(s)	615
AciI	CCGC	2 cut(s)	407, 521
AclWI	GGATC	1 cut(s)	161
AcsI	RAATTY	1 cut(s)	183
AgsI	TTSAA	5 cut(s)	218, 243, 346, 422, 460
AluBI	AGCT	3 cut(s)	349, 463, 622
AluI	AGCT	3 cut(s)	349, 463, 622
Alw21I	GWGCWC	1 cut(s)	214
AlwI	GGATC	1 cut(s)	161
Aor13HI	TCCGGA	1 cut(s)	615
ApoI	RAATTY	1 cut(s)	183
ArsI	GACNNNNNNTTYG	2 cut(s)	539, 571
AsuHPI	GGTGA	2 cut(s)	413, 527
AsuII	TTCGAA	1 cut(s)	748
BauI	CACGAG	2 cut(s)	396, 510
Bbv12I	GWGCWC	1 cut(s)	214
BciVI	GTATCC	1 cut(s)	623
BfaI	CTAG	2 cut(s)	336, 450
BfuAI	ACCTGC	1 cut(s)	712
BfuI	GTATCC	1 cut(s)	623
BmsI	GCATC	3 cut(s)	87, 394, 508
Bpu14I	TTCGAA	1 cut(s)	748
BsaWI	WCCGGW	2 cut(s)	478, 615
Bse1I	ACTGG	2 cut(s)	250, 661
BseAI	TCCGGA	1 cut(s)	615
BseGI	GGATG	3 cut(s)	15, 259, 763
BseMII	CTCAG	1 cut(s)	141
BseNI	ACTGG	2 cut(s)	250, 661
BseRI	GAGGAG	2 cut(s)	248, 575
BsiHKAI	GWGCWC	1 cut(s)	214
BsiSI	CCGG	2 cut(s)	479, 616
BsmI	GAATGC	1 cut(s)	756
Bsp119I	TTCGAA	1 cut(s)	748
Bsp1286I	GDGCHC	1 cut(s)	214
Bsp13I	TCCGGA	1 cut(s)	615
Bsp143I	GATC	3 cut(s)	166, 528, 627
BspACI	CCGC	2 cut(s)	407, 521
BspCNI	CTCAG	1 cut(s)	140
BspEI	TCCGGA	1 cut(s)	615
BspMI	ACCTGC	1 cut(s)	712
BspPI	GGATC	1 cut(s)	161
BspT104I	TTCGAA	1 cut(s)	748
BsrI	ACTGG	2 cut(s)	250, 661
BssMI	GATC	3 cut(s)	166, 528, 627
BssSI	CACGAG	2 cut(s)	396, 510
Bst2BI	CACGAG	2 cut(s)	396, 510
Bst4CI	ACNGT	1 cut(s)	119
BstBI	TTCGAA	1 cut(s)	748
BstC8I	GCNNGC	1 cut(s)	102
BstDEI	CTNAG	2 cut(s)	127, 712
BstF5I	GGATG	3 cut(s)	15, 259, 763
BstKTI	GATC	3 cut(s)	169, 531, 630
BstMBI	GATC	3 cut(s)	166, 528, 627
BstNSI	RCATGY	2 cut(s)	417, 650
BstX2I	RGATCY	1 cut(s)	166
BstYI	RGATCY	1 cut(s)	166
BsuI	GTATCC	1 cut(s)	623
BtsCI	GGATG	3 cut(s)	15, 259, 763
BveI	ACCTGC	1 cut(s)	712
Cac8I	GCNNGC	1 cut(s)	102
CseI	GACGC	1 cut(s)	2
CviAII	CATG	6 cut(s)	143, 380, 414, 494, 608, 647
CviJI	RGCY	5 cut(s)	29, 104, 349, 463, 622
CviKI_1	RGCY	5 cut(s)	29, 104, 349, 463, 622
DdeI	CTNAG	2 cut(s)	127, 712
DpnI	GATC	3 cut(s)	168, 530, 629
DpnII	GATC	3 cut(s)	166, 528, 627
EcoT22I	ATGCAT	2 cut(s)	144, 756
FaeI	CATG	6 cut(s)	146, 383, 417, 497, 611, 650
FatI	CATG	6 cut(s)	142, 379, 413, 493, 607, 646
FauI	CCCGC	1 cut(s)	400
FokI	GGATG	3 cut(s)	22, 266, 750
FspBI	CTAG	2 cut(s)	336, 450
HapII	CCGG	2 cut(s)	479, 616
HgaI	GACGC	1 cut(s)	2
Hin1II	CATG	6 cut(s)	146, 383, 417, 497, 611, 650
HindIII	AAGCTT	1 cut(s)	620
HinfI	GANTC	3 cut(s)	370, 484, 580
HpaII	CCGG	2 cut(s)	479, 616
HphI	GGTGA	2 cut(s)	413, 527
Hpy166II	GTNNAC	1 cut(s)	77
Hpy188I	TCNGA	4 cut(s)	130, 353, 467, 528
Hpy188III	TCNNGA	5 cut(s)	17, 419, 616, 694, 767
Hpy8I	GTNNAC	1 cut(s)	77
Hpy99I	CGWCG	1 cut(s)	18
HpyAV	CCTTC	3 cut(s)	14, 65, 253
HpyCH4III	ACNGT	1 cut(s)	119
HpyCH4V	TGCA	3 cut(s)	142, 742, 754
HpyF3I	CTNAG	2 cut(s)	127, 712
Hsp92II	CATG	6 cut(s)	146, 383, 417, 497, 611, 650
Kpn2I	TCCGGA	1 cut(s)	615
Kzo9I	GATC	3 cut(s)	166, 528, 627
LmnI	GCTCC	3 cut(s)	209, 410, 643
LweI	GCATC	3 cut(s)	87, 394, 508
MaeI	CTAG	2 cut(s)	336, 450
MaeIII	GTNAC	2 cut(s)	330, 444
MalI	GATC	3 cut(s)	168, 530, 629
MboI	GATC	3 cut(s)	166, 528, 627
MboII	GAAGA	3 cut(s)	382, 496, 602
MflI	RGATCY	1 cut(s)	166
MhlI	GDGCHC	1 cut(s)	214
MluCI	AATT	5 cut(s)	84, 183, 219, 296, 550
MnlI	CCTC	7 cut(s)	136, 226, 229, 463, 553, 556, 570
Mph1103I	ATGCAT	2 cut(s)	144, 756
MroI	TCCGGA	1 cut(s)	615
MseI	TTAA	2 cut(s)	327, 441
MslI	CAYNNNNRTG	3 cut(s)	536, 606, 768
MspI	CCGG	2 cut(s)	479, 616
Mva1269I	GAATGC	1 cut(s)	756
NdeII	GATC	3 cut(s)	166, 528, 627
NlaIII	CATG	6 cut(s)	146, 383, 417, 497, 611, 650
NsiI	ATGCAT	2 cut(s)	144, 756
NspI	RCATGY	2 cut(s)	417, 650
NspV	TTCGAA	1 cut(s)	748
PaqCI	CACCTGC	1 cut(s)	712
PctI	GAATGC	1 cut(s)	756
PfeI	GAWTC	3 cut(s)	370, 484, 580
PsuI	RGATCY	1 cut(s)	166
RseI	CAYNNNNRTG	3 cut(s)	536, 606, 768
SaqAI	TTAA	2 cut(s)	327, 441
Sau3AI	GATC	3 cut(s)	166, 528, 627
SduI	GDGCHC	1 cut(s)	214
SfaNI	GCATC	3 cut(s)	87, 394, 508
SfuI	TTCGAA	1 cut(s)	748
SmiMI	CAYNNNNRTG	3 cut(s)	536, 606, 768
Sse9I	AATT	5 cut(s)	84, 183, 219, 296, 550
SsiI	CCGC	2 cut(s)	407, 521
SspI	AATATT	1 cut(s)	266
SspMI	CTAG	2 cut(s)	336, 450
TaaI	ACNGT	1 cut(s)	119
TaqI	TCGA	2 cut(s)	16, 748
TasI	AATT	5 cut(s)	84, 183, 219, 296, 550
TfiI	GAWTC	3 cut(s)	370, 484, 580
Tru1I	TTAA	2 cut(s)	327, 441
Tru9I	TTAA	2 cut(s)	327, 441
TspDTI	ATGAA	3 cut(s)	195, 212, 554
XapI	RAATTY	1 cut(s)	183
XceI	RCATGY	2 cut(s)	417, 650
XspI	CTAG	2 cut(s)	336, 450
Zsp2I	ATGCAT	2 cut(s)	144, 756

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.