Rmu_sc0032413.1_g000001

FAD-dependent monooxygenase required for the C5-ring hydroxylation during ubiquinone biosynthesis. Catalyzes the hydroxylation of 3-polyprenyl-4-hydroxybenzoic acid to 3- polyprenyl-4,5-dihydroxybenzoic acid. The electrons required for the hydroxylation reaction may be funneled indirectly from NADPH via a ferredoxin ferredoxin reductase system to COQ6

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0032413.1
Physical Location & Seq
Reverse (-)
1 .. 666
666 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0032413.1_g000001.1.cds

Sequence Viewer

Length: 223 bp
atgaacagcttgatcagaagaaagctcgttgaaaatgcatacagattgaaactttcacacaagggtttctgtactggtgcagctgctaaagtttccagctccaatggtgcccaaccaagcaatgatcatgtggggcggcagaaatcttcaaataaaagcgaaccgcatgacattgctattgttggaggaggcatggttggcatggccctagcttgttccttgg
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

74

Amino Acids

7.75

Weight (kDa)

9.92

Isoelectric Point (pI)

42.09

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 107
AciI CCGC 2 cut(s) 136, 164
AfaI GTAC 1 cut(s) 73
AgsI TTSAA 3 cut(s) 32, 49, 150
AluBI AGCT 5 cut(s) 9, 25, 83, 99, 212
AluI AGCT 5 cut(s) 9, 25, 83, 99, 212
AoxI GGCC 1 cut(s) 204
ApeKI GCWGC 2 cut(s) 80, 83
AspS9I GGNCC 1 cut(s) 205
BaeGI GKGCMC 1 cut(s) 112
BanI GGYRCC 1 cut(s) 107
BbvI GCAGC 2 cut(s) 70, 92
BclI TGATCA 2 cut(s) 12, 124
BfaI CTAG 1 cut(s) 209
BisI GCNGC 3 cut(s) 81, 84, 137
BlsI GCNGC 3 cut(s) 82, 85, 138
BmgT120I GGNCC 1 cut(s) 205
BmiI GGNNCC 1 cut(s) 109
BsaJI CCNNGG 1 cut(s) 219
BsaXI ACNNNNNCTCC 2 cut(s) 180, 210
Bse1I ACTGG 1 cut(s) 79
Bse3DI GCAATG 2 cut(s) 127, 171
BseDI CCNNGG 1 cut(s) 219
BseMI GCAATG 2 cut(s) 127, 171
BseNI ACTGG 1 cut(s) 79
BseRI GAGGAG 1 cut(s) 201
BseSI GKGCMC 1 cut(s) 112
BseXI GCAGC 2 cut(s) 70, 92
BsgI GTGCAG 1 cut(s) 99
BshFI GGCC 1 cut(s) 206
BshNI GGYRCC 1 cut(s) 107
BsnI GGCC 1 cut(s) 206
Bsp1286I GDGCHC 1 cut(s) 112
Bsp143I GATC 2 cut(s) 12, 124
BspACI CCGC 2 cut(s) 136, 164
BspANI GGCC 1 cut(s) 206
BspLI GGNNCC 1 cut(s) 109
BspT107I GGYRCC 1 cut(s) 107
BsrDI GCAATG 2 cut(s) 127, 171
BsrI ACTGG 1 cut(s) 79
BssECI CCNNGG 1 cut(s) 219
BssMI GATC 2 cut(s) 12, 124
BssT1I CCWWGG 1 cut(s) 219
BstKTI GATC 2 cut(s) 15, 127
BstMBI GATC 2 cut(s) 12, 124
BstMWI GCNNNNNNNGC 1 cut(s) 198
BstSLI GKGCMC 1 cut(s) 112
BstV1I GCAGC 2 cut(s) 70, 92
BsuRI GGCC 1 cut(s) 206
Cfr13I GGNCC 1 cut(s) 205
Csp6I GTAC 1 cut(s) 72
CviAII CATG 4 cut(s) 128, 167, 193, 202
CviJI RGCY 6 cut(s) 9, 25, 83, 99, 206, 212
CviKI_1 RGCY 6 cut(s) 9, 25, 83, 99, 206, 212
CviQI GTAC 1 cut(s) 72
DpnI GATC 2 cut(s) 14, 126
DpnII GATC 2 cut(s) 12, 124
Eco130I CCWWGG 1 cut(s) 219
EcoT14I CCWWGG 1 cut(s) 219
EcoT22I ATGCAT 1 cut(s) 40
ErhI CCWWGG 1 cut(s) 219
FaeI CATG 4 cut(s) 131, 170, 196, 205
FaiI YATR 5 cut(s) 40, 129, 168, 194, 203
FatI CATG 4 cut(s) 127, 166, 192, 201
FbaI TGATCA 2 cut(s) 12, 124
Fnu4HI GCNGC 3 cut(s) 81, 84, 137
Fsp4HI GCNGC 3 cut(s) 81, 84, 137
FspBI CTAG 1 cut(s) 209
GluI GCNGC 3 cut(s) 81, 84, 137
HaeIII GGCC 1 cut(s) 206
Hin1II CATG 4 cut(s) 131, 170, 196, 205
Hpy188I TCNGA 1 cut(s) 17
HpyCH4V TGCA 2 cut(s) 38, 80
HpyF10VI GCNNNNNNNGC 1 cut(s) 198
Hsp92II CATG 4 cut(s) 131, 170, 196, 205
Ksp22I TGATCA 2 cut(s) 12, 124
Kzo9I GATC 2 cut(s) 12, 124
LmnI GCTCC 1 cut(s) 104
LpnPI CCDG 2 cut(s) 60, 109
Lsp1109I GCAGC 2 cut(s) 70, 92
MaeI CTAG 1 cut(s) 209
MalI GATC 2 cut(s) 14, 126
MboI GATC 2 cut(s) 12, 124
MboII GAAGA 2 cut(s) 30, 138
MhlI GDGCHC 1 cut(s) 112
MmeI TCCRAC 1 cut(s) 163
MnlI CCTC 2 cut(s) 179, 182
Mph1103I ATGCAT 1 cut(s) 40
MspA1I CMGCKG 1 cut(s) 83
MwoI GCNNNNNNNGC 1 cut(s) 198
NdeII GATC 2 cut(s) 12, 124
NlaIII CATG 4 cut(s) 131, 170, 196, 205
NlaIV GGNNCC 1 cut(s) 109
NsiI ATGCAT 1 cut(s) 40
PkrI GCNGC 3 cut(s) 82, 85, 138
PspN4I GGNNCC 1 cut(s) 109
PspPI GGNCC 1 cut(s) 205
PvuII CAGCTG 1 cut(s) 83
RsaI GTAC 1 cut(s) 73
RsaNI GTAC 1 cut(s) 72
SatI GCNGC 3 cut(s) 81, 84, 137
Sau3AI GATC 2 cut(s) 12, 124
Sau96I GGNCC 1 cut(s) 205
SduI GDGCHC 1 cut(s) 112
SetI ASST 5 cut(s) 11, 27, 85, 101, 214
SsiI CCGC 2 cut(s) 136, 164
SspMI CTAG 1 cut(s) 209
StyI CCWWGG 1 cut(s) 219
TatI WGTACW 1 cut(s) 71
TauI GCSGC 1 cut(s) 139
TseI GCWGC 2 cut(s) 80, 83
TspDTI ATGAA 1 cut(s) 17
XspI CTAG 1 cut(s) 209
Zsp2I ATGCAT 1 cut(s) 40
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.