Rh6CG115900

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6C
Physical Location & Seq
Forward (+)
13296694 .. 13297671
978 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6CG115900.1

Sequence Viewer

Length: 222 bp
ATGAATTCCCTGAAGTCAAGGAGCAAAGCAAGGTTTAATCCCCCTTGCTATACCACTTTCAAGAAATATCTCAGGTGCTGTAACTGCATTGCTCCGGTGGCCTACAGCTCTGCAAGGATGAGTATGTCTGGAAATAATTGGAAAAGACTTGATAATGTTTTAGGAACATTGATAAATCCCTCTGGTGAAATGTCCTGTGCTGGGTTAAGTGAACAAAACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

73

Amino Acids

8.11

Weight (kDa)

9.55

Isoelectric Point (pI)

56.93

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 4
AcuI CTGAAG 1 cut(s) 32
AfiI CCNNNNNNNGG 1 cut(s) 201
AgsI TTSAA 1 cut(s) 61
AluBI AGCT 1 cut(s) 108
AluI AGCT 1 cut(s) 108
AlwNI CAGNNNCTG 1 cut(s) 78
AoxI GGCC 1 cut(s) 99
ApoI RAATTY 1 cut(s) 4
AsuHPI GGTGA 1 cut(s) 197
BfmI CTRYAG 1 cut(s) 103
BsaWI WCCGGW 1 cut(s) 94
Bsc4I CCNNNNNNNGG 1 cut(s) 201
Bse3DI GCAATG 1 cut(s) 87
BseGI GGATG 1 cut(s) 123
BseLI CCNNNNNNNGG 1 cut(s) 201
BseMI GCAATG 1 cut(s) 87
BseMII CTCAG 1 cut(s) 85
BseYI CCCAGC 1 cut(s) 200
BshFI GGCC 1 cut(s) 101
BsiSI CCGG 1 cut(s) 95
BslI CCNNNNNNNGG 1 cut(s) 201
BsnI GGCC 1 cut(s) 101
BspANI GGCC 1 cut(s) 101
BspCNI CTCAG 1 cut(s) 84
BsrDI GCAATG 1 cut(s) 87
BstDEI CTNAG 1 cut(s) 71
BstF5I GGATG 1 cut(s) 123
BstMWI GCNNNNNNNGC 2 cut(s) 84, 98
BstSFI CTRYAG 1 cut(s) 103
BsuRI GGCC 1 cut(s) 101
BtsCI GGATG 1 cut(s) 123
CaiI CAGNNNCTG 1 cut(s) 78
CviJI RGCY 2 cut(s) 101, 108
CviKI_1 RGCY 2 cut(s) 101, 108
DdeI CTNAG 1 cut(s) 71
Eco57I CTGAAG 1 cut(s) 32
EcoRI GAATTC 1 cut(s) 4
FaiI YATR 2 cut(s) 51, 125
FokI GGATG 1 cut(s) 130
GsaI CCCAGC 1 cut(s) 204
HaeIII GGCC 1 cut(s) 101
HapII CCGG 1 cut(s) 95
HpaII CCGG 1 cut(s) 95
HphI GGTGA 1 cut(s) 197
Hpy166II GTNNAC 1 cut(s) 212
Hpy188III TCNNGA 2 cut(s) 61, 129
Hpy8I GTNNAC 1 cut(s) 212
HpyCH4V TGCA 2 cut(s) 87, 113
HpyF10VI GCNNNNNNNGC 2 cut(s) 84, 98
HpyF3I CTNAG 1 cut(s) 71
LmnI GCTCC 2 cut(s) 21, 97
LpnPI CCDG 7 cut(s) 23, 58, 108, 114, 168, 186, 208
MaeIII GTNAC 1 cut(s) 80
MluCI AATT 2 cut(s) 4, 136
MnlI CCTC 1 cut(s) 190
MseI TTAA 2 cut(s) 36, 206
MspI CCGG 1 cut(s) 95
MwoI GCNNNNNNNGC 2 cut(s) 84, 98
PspFI CCCAGC 1 cut(s) 200
PstNI CAGNNNCTG 1 cut(s) 78
SaqAI TTAA 2 cut(s) 36, 206
SetI ASST 3 cut(s) 35, 77, 110
SfcI CTRYAG 1 cut(s) 103
Sse9I AATT 2 cut(s) 4, 136
TasI AATT 2 cut(s) 4, 136
Tru1I TTAA 2 cut(s) 36, 206
Tru9I TTAA 2 cut(s) 36, 206
TspDTI ATGAA 1 cut(s) 17
XapI RAATTY 1 cut(s) 4
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.