Rroxscaffold_2G00151150

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
Physical Location & Seq
Forward (+)
88432653 .. 88435721
3069 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00151150.1

Sequence Viewer

Length: 162 bp
ATGCCTTATCATCTCCGGCAGAAGTTGCCTCTTCCTAAATACGAACCCTACTTTTGGTCAAATGCAAATAAGGGCACTTTTCTATTCTCATTGCAGAGAATTGGCATCCAAGATTATGAATTTCCTGCAACGAAAGGCATATTTTATTCCCCGTGGAGCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

53

Amino Acids

6.37

Weight (kDa)

9.46

Isoelectric Point (pI)

63.89

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 119
AfiI CCNNNNNNNGG 1 cut(s) 54
AluBI AGCT 1 cut(s) 159
AluI AGCT 1 cut(s) 159
ApoI RAATTY 1 cut(s) 119
BaeGI GKGCMC 1 cut(s) 77
BmsI GCATC 1 cut(s) 114
BsaJI CCNNGG 1 cut(s) 152
Bsc4I CCNNNNNNNGG 1 cut(s) 54
Bse3DI GCAATG 1 cut(s) 89
BseDI CCNNGG 1 cut(s) 152
BseGI GGATG 1 cut(s) 105
BseLI CCNNNNNNNGG 1 cut(s) 54
BseMI GCAATG 1 cut(s) 89
BseSI GKGCMC 1 cut(s) 77
BsiSI CCGG 1 cut(s) 16
BslI CCNNNNNNNGG 1 cut(s) 54
Bsp1286I GDGCHC 1 cut(s) 77
BsrDI GCAATG 1 cut(s) 89
BssECI CCNNGG 1 cut(s) 152
Bst6I CTCTTC 1 cut(s) 36
BstAPI GCANNNNNTGC 1 cut(s) 25
BstDSI CCRYGG 1 cut(s) 152
BstF5I GGATG 1 cut(s) 105
BstMWI GCNNNNNNNGC 1 cut(s) 25
BstSLI GKGCMC 1 cut(s) 77
BtgI CCRYGG 1 cut(s) 152
BtsCI GGATG 1 cut(s) 105
CviJI RGCY 1 cut(s) 159
CviKI_1 RGCY 1 cut(s) 159
Eam1104I CTCTTC 1 cut(s) 36
EarI CTCTTC 1 cut(s) 36
FaiI YATR 2 cut(s) 117, 140
FokI GGATG 1 cut(s) 92
HapII CCGG 1 cut(s) 16
HpaII CCGG 1 cut(s) 16
HpyCH4V TGCA 3 cut(s) 65, 94, 128
HpyF10VI GCNNNNNNNGC 1 cut(s) 25
LmnI GCTCC 1 cut(s) 156
LpnPI CCDG 2 cut(s) 29, 138
LweI GCATC 1 cut(s) 114
MboII GAAGA 1 cut(s) 23
MhlI GDGCHC 1 cut(s) 77
MluCI AATT 2 cut(s) 99, 119
MnlI CCTC 1 cut(s) 39
MspI CCGG 1 cut(s) 16
MwoI GCNNNNNNNGC 1 cut(s) 25
SduI GDGCHC 1 cut(s) 77
SetI ASST 1 cut(s) 161
SfaNI GCATC 1 cut(s) 114
SgeI CNNG 3 cut(s) 28, 122, 137
Sse9I AATT 2 cut(s) 99, 119
TasI AATT 2 cut(s) 99, 119
TspDTI ATGAA 1 cut(s) 132
XapI RAATTY 1 cut(s) 119
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.