Rh7DG284600

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7D
Physical Location & Seq
Reverse (-)
31238400 .. 31258792
20393 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7DG284600.1

Sequence Viewer

Length: 303 bp
ATGTCTTCTTCGAGGAGTGGGGAAGAAAAAGACTTAGGACCGGGCCGTTTCTGTGGTACTGAAGCCGTTGTCGAACTGGAGGATGGAATTCTTATTAATCCTCCAGAAAGGTTTTACTTATCTTATGTTGCTTGGCAGTATCTATTGACAACAATTGGCCAAGAAGCTTCAAGAAATCGAAGGAGCAAAGCAAGGTTTAATCCCCCTTGCTATACCACTTTCAAGAAATATCTCAGGTGCTGTAACTGCATTGCTCCGGTGGCCTACAGCTCTGCAAGGATGAGTGTTAGAAAATTGGACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

100

Amino Acids

11.37

Weight (kDa)

9.1

Isoelectric Point (pI)

62.87

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 157
AcsI RAATTY 1 cut(s) 87
AcuI CTGAAG 1 cut(s) 81
AfaI GTAC 1 cut(s) 58
AgsI TTSAA 2 cut(s) 171, 223
AluBI AGCT 2 cut(s) 167, 270
AluI AGCT 2 cut(s) 167, 270
AlwNI CAGNNNCTG 1 cut(s) 240
AoxI GGCC 3 cut(s) 43, 157, 261
ApoI RAATTY 1 cut(s) 87
AseI ATTAAT 1 cut(s) 96
AspS9I GGNCC 2 cut(s) 38, 43
AsuC2I CCSGG 1 cut(s) 42
AvaII GGWCC 1 cut(s) 38
BalI TGGCCA 1 cut(s) 159
BccI CCATC 1 cut(s) 77
BceAI ACGGC 2 cut(s) 30, 50
BcnI CCSGG 1 cut(s) 42
BfaI CTAG 1 cut(s) 301
BfmI CTRYAG 1 cut(s) 265
Bme1390I CCNGG 1 cut(s) 42
Bme18I GGWCC 1 cut(s) 38
BmgT120I GGNCC 2 cut(s) 38, 43
BmrFI CCNGG 1 cut(s) 42
BpmI CTGGAG 2 cut(s) 87, 98
BpuMI CCSGG 1 cut(s) 42
BsaWI WCCGGW 1 cut(s) 256
Bse1I ACTGG 1 cut(s) 81
Bse3DI GCAATG 1 cut(s) 249
BseGI GGATG 2 cut(s) 88, 285
BseMI GCAATG 1 cut(s) 249
BseMII CTCAG 1 cut(s) 247
BseNI ACTGG 1 cut(s) 81
BseRI GAGGAG 1 cut(s) 28
BshFI GGCC 3 cut(s) 45, 159, 263
BsiSI CCGG 2 cut(s) 41, 257
BsnI GGCC 3 cut(s) 45, 159, 263
BspANI GGCC 3 cut(s) 45, 159, 263
BspCNI CTCAG 1 cut(s) 246
BsrDI GCAATG 1 cut(s) 249
BsrI ACTGG 1 cut(s) 81
BstDEI CTNAG 2 cut(s) 34, 233
BstF5I GGATG 2 cut(s) 88, 285
BstMWI GCNNNNNNNGC 2 cut(s) 246, 260
BstSCI CCNGG 1 cut(s) 40
BstSFI CTRYAG 1 cut(s) 265
BsuRI GGCC 3 cut(s) 45, 159, 263
BtsCI GGATG 2 cut(s) 88, 285
CaiI CAGNNNCTG 1 cut(s) 240
Cfr13I GGNCC 2 cut(s) 38, 43
Csp6I GTAC 1 cut(s) 57
CviJI RGCY 6 cut(s) 45, 65, 159, 167, 263, 270
CviKI_1 RGCY 6 cut(s) 45, 65, 159, 167, 263, 270
CviQI GTAC 1 cut(s) 57
DdeI CTNAG 2 cut(s) 34, 233
EaeI YGGCCR 1 cut(s) 157
Eco47I GGWCC 1 cut(s) 38
Eco57I CTGAAG 1 cut(s) 81
EcoRI GAATTC 1 cut(s) 87
FaiI YATR 2 cut(s) 126, 213
FokI GGATG 2 cut(s) 95, 292
FspBI CTAG 1 cut(s) 301
GsuI CTGGAG 2 cut(s) 87, 98
HaeIII GGCC 3 cut(s) 45, 159, 263
HapII CCGG 2 cut(s) 41, 257
HindIII AAGCTT 1 cut(s) 165
HpaII CCGG 2 cut(s) 41, 257
Hpy188III TCNNGA 3 cut(s) 104, 171, 223
HpyAV CCTTC 1 cut(s) 174
HpyCH4V TGCA 2 cut(s) 249, 275
HpyF10VI GCNNNNNNNGC 2 cut(s) 246, 260
HpyF3I CTNAG 2 cut(s) 34, 233
LmnI GCTCC 2 cut(s) 183, 259
LpnPI CCDG 5 cut(s) 54, 62, 117, 220, 270
MaeI CTAG 1 cut(s) 301
MaeIII GTNAC 1 cut(s) 242
MboII GAAGA 1 cut(s) 35
MfeI CAATTG 1 cut(s) 153
MlsI TGGCCA 1 cut(s) 159
MluCI AATT 3 cut(s) 87, 153, 293
MluNI TGGCCA 1 cut(s) 159
MnlI CCTC 3 cut(s) 6, 73, 111
Mox20I TGGCCA 1 cut(s) 159
MscI TGGCCA 1 cut(s) 159
MseI TTAA 2 cut(s) 96, 198
Msp20I TGGCCA 1 cut(s) 159
MspI CCGG 2 cut(s) 41, 257
MspR9I CCNGG 1 cut(s) 42
MunI CAATTG 1 cut(s) 153
MwoI GCNNNNNNNGC 2 cut(s) 246, 260
NciI CCSGG 1 cut(s) 42
PshBI ATTAAT 1 cut(s) 96
PspPI GGNCC 2 cut(s) 38, 43
PstNI CAGNNNCTG 1 cut(s) 240
RsaI GTAC 1 cut(s) 58
RsaNI GTAC 1 cut(s) 57
SaqAI TTAA 2 cut(s) 96, 198
Sau96I GGNCC 2 cut(s) 38, 43
ScrFI CCNGG 1 cut(s) 42
SetI ASST 5 cut(s) 113, 169, 197, 239, 272
SfcI CTRYAG 1 cut(s) 265
SinI GGWCC 1 cut(s) 38
Sse9I AATT 3 cut(s) 87, 153, 293
SspMI CTAG 1 cut(s) 301
StyD4I CCNGG 1 cut(s) 40
TaqI TCGA 3 cut(s) 11, 72, 178
TasI AATT 3 cut(s) 87, 153, 293
Tru1I TTAA 2 cut(s) 96, 198
Tru9I TTAA 2 cut(s) 96, 198
VpaK11BI GGWCC 1 cut(s) 38
VspI ATTAAT 1 cut(s) 96
XapI RAATTY 1 cut(s) 87
XspI CTAG 1 cut(s) 301
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.