Rmu_ssc0000042.1_g000053

FAD binding domain

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000042.1
Physical Location & Seq
Forward (+)
315906 .. 316397
492 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000042.1_g000053.1.cds

Sequence Viewer

Length: 492 bp
atgaacttctcaactgagtcagtgaaggattttcctagtagcattaaagagatggtcaacaattgctggctggagtacttacatttctcagagtacatcaaataccgatcaccatggaacatactatgtacacactttcgggtaggaacagtgacagttgcaggagatgccttgcatgcaatgactccgttcattgctcagggtggctcaactgctttggaagacgcagttgtccttgctaggtgcttcgcacgaaaggctgttgtcggtggtccaggtgaaataggaagcaaacttatggtagagaaagcatttgatgaatacctaaaagagcggaaaatacgacttctaagactcactatcgaatcaaccctaatcggaaagatggaagaaacttcatcaaagctcatcaagctcttatatattgtgctcatggtggtcctatttcgcaactcatttgctcacgctcgctatgactgtggcaaactctaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

163

Amino Acids

18.43

Weight (kDa)

8.88

Isoelectric Point (pI)

35.35

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 230
AccBSI CCGCTC 1 cut(s) 334
AciI CCGC 1 cut(s) 334
AfaI GTAC 3 cut(s) 77, 95, 130
AjnI CCWGG 1 cut(s) 274
AluBI AGCT 2 cut(s) 406, 415
AluI AGCT 2 cut(s) 406, 415
Alw21I GWGCWC 1 cut(s) 432
AspS9I GGNCC 2 cut(s) 272, 439
AsuHPI GGTGA 2 cut(s) 102, 290
AvaII GGWCC 2 cut(s) 272, 439
BbsI GAAGAC 1 cut(s) 228
Bbv12I GWGCWC 1 cut(s) 432
BccI CCATC 2 cut(s) 46, 379
BciT130I CCWGG 1 cut(s) 276
BfaI CTAG 2 cut(s) 36, 240
BmcAI AGTACT 1 cut(s) 77
Bme1390I CCNGG 1 cut(s) 276
Bme18I GGWCC 2 cut(s) 272, 439
BmgT120I GGNCC 2 cut(s) 272, 439
BmrFI CCNGG 1 cut(s) 276
BmsI GCATC 1 cut(s) 157
BpiI GAAGAC 1 cut(s) 228
BpmI CTGGAG 1 cut(s) 92
Bpu10I CCTNAGC 1 cut(s) 198
BsaJI CCNNGG 1 cut(s) 113
Bse3DI GCAATG 2 cut(s) 186, 192
BseBI CCWGG 1 cut(s) 276
BseDI CCNNGG 1 cut(s) 113
BseMI GCAATG 2 cut(s) 186, 192
BseMII CTCAG 3 cut(s) 6, 102, 212
BsiHKAI GWGCWC 1 cut(s) 432
Bsp1286I GDGCHC 1 cut(s) 432
Bsp1407I TGTACA 1 cut(s) 128
Bsp143I GATC 1 cut(s) 107
Bsp19I CCATGG 1 cut(s) 113
BspACI CCGC 1 cut(s) 334
BspCNI CTCAG 3 cut(s) 7, 101, 211
BsrBI CCGCTC 1 cut(s) 334
BsrDI GCAATG 2 cut(s) 186, 192
BsrGI TGTACA 1 cut(s) 128
BssECI CCNNGG 1 cut(s) 113
BssMI GATC 1 cut(s) 107
BssT1I CCWWGG 1 cut(s) 113
Bst2UI CCWGG 1 cut(s) 276
Bst4CI ACNGT 3 cut(s) 151, 157, 479
BstAPI GCANNNNNTGC 1 cut(s) 167
BstAUI TGTACA 1 cut(s) 128
BstC8I GCNNGC 3 cut(s) 68, 177, 469
BstDEI CTNAG 4 cut(s) 15, 88, 198, 350
BstDSI CCRYGG 1 cut(s) 113
BstKTI GATC 1 cut(s) 110
BstMBI GATC 1 cut(s) 107
BstMWI GCNNNNNNNGC 4 cut(s) 167, 176, 257, 412
BstNI CCWGG 1 cut(s) 276
BstNSI RCATGY 1 cut(s) 179
BstSCI CCNGG 1 cut(s) 274
BstV2I GAAGAC 1 cut(s) 228
BtgI CCRYGG 1 cut(s) 113
BtsIMutI CAGTG 2 cut(s) 27, 156
Cac8I GCNNGC 3 cut(s) 68, 177, 469
Cfr13I GGNCC 2 cut(s) 272, 439
CseI GACGC 1 cut(s) 233
Csp6I GTAC 3 cut(s) 76, 94, 129
CviAII CATG 3 cut(s) 114, 176, 433
CviJI RGCY 5 cut(s) 70, 207, 260, 406, 415
CviKI_1 RGCY 5 cut(s) 70, 207, 260, 406, 415
CviQI GTAC 3 cut(s) 76, 94, 129
DdeI CTNAG 4 cut(s) 15, 88, 198, 350
DpnI GATC 1 cut(s) 109
DpnII GATC 1 cut(s) 107
DrdI GACNNNNNNGTC 1 cut(s) 230
DseDI GACNNNNNNGTC 1 cut(s) 230
Eco130I CCWWGG 1 cut(s) 113
Eco47I GGWCC 2 cut(s) 272, 439
EcoRII CCWGG 1 cut(s) 274
EcoT14I CCWWGG 1 cut(s) 113
ErhI CCWWGG 1 cut(s) 113
FaeI CATG 3 cut(s) 117, 179, 436
FaiI YATR 9 cut(s) 115, 122, 127, 177, 299, 421, 423, 434, 474
FatI CATG 3 cut(s) 113, 175, 432
FspBI CTAG 2 cut(s) 36, 240
GsuI CTGGAG 1 cut(s) 92
HgaI GACGC 1 cut(s) 233
Hin1II CATG 3 cut(s) 117, 179, 436
HincII GTYRAC 1 cut(s) 58
HindII GTYRAC 1 cut(s) 58
HinfI GANTC 4 cut(s) 17, 184, 354, 365
HphI GGTGA 2 cut(s) 102, 290
Hpy166II GTNNAC 2 cut(s) 58, 131
Hpy188I TCNGA 2 cut(s) 91, 380
Hpy8I GTNNAC 2 cut(s) 58, 131
HpyAV CCTTC 1 cut(s) 19
HpyCH4III ACNGT 3 cut(s) 151, 157, 479
HpyCH4V TGCA 3 cut(s) 161, 175, 179
HpyF10VI GCNNNNNNNGC 4 cut(s) 167, 176, 257, 412
HpyF3I CTNAG 4 cut(s) 15, 88, 198, 350
Hsp92II CATG 3 cut(s) 117, 179, 436
Kzo9I GATC 1 cut(s) 107
LpnPI CCDG 6 cut(s) 52, 56, 147, 185, 261, 288
LweI GCATC 1 cut(s) 157
MaeI CTAG 2 cut(s) 36, 240
MaeIII GTNAC 1 cut(s) 151
MalI GATC 1 cut(s) 109
MbiI CCGCTC 1 cut(s) 334
MboI GATC 1 cut(s) 107
MboII GAAGA 2 cut(s) 233, 401
MfeI CAATTG 1 cut(s) 61
MhlI GDGCHC 1 cut(s) 432
MluCI AATT 1 cut(s) 61
MlyI GAGTC 3 cut(s) 26, 178, 348
MseI TTAA 1 cut(s) 45
MspR9I CCNGG 1 cut(s) 276
MunI CAATTG 1 cut(s) 61
MvaI CCWGG 1 cut(s) 276
MwoI GCNNNNNNNGC 4 cut(s) 167, 176, 257, 412
NcoI CCATGG 1 cut(s) 113
NdeII GATC 1 cut(s) 107
NlaIII CATG 3 cut(s) 117, 179, 436
NmuCI GTSAC 1 cut(s) 151
NspI RCATGY 1 cut(s) 179
PaeI GCATGC 1 cut(s) 179
PfeI GAWTC 1 cut(s) 365
PleI GAGTC 3 cut(s) 25, 178, 348
PpsI GAGTC 3 cut(s) 25, 178, 348
Psp6I CCWGG 1 cut(s) 274
PspGI CCWGG 1 cut(s) 274
PspPI GGNCC 2 cut(s) 272, 439
RsaI GTAC 3 cut(s) 77, 95, 130
RsaNI GTAC 3 cut(s) 76, 94, 129
SaqAI TTAA 1 cut(s) 45
Sau3AI GATC 1 cut(s) 107
Sau96I GGNCC 2 cut(s) 272, 439
ScaI AGTACT 1 cut(s) 77
SchI GAGTC 3 cut(s) 26, 178, 348
ScrFI CCNGG 1 cut(s) 276
SduI GDGCHC 1 cut(s) 432
SetI ASST 5 cut(s) 245, 280, 327, 408, 417
SfaNI GCATC 1 cut(s) 157
SinI GGWCC 2 cut(s) 272, 439
SphI GCATGC 1 cut(s) 179
Sse9I AATT 1 cut(s) 61
SsiI CCGC 1 cut(s) 334
SspMI CTAG 2 cut(s) 36, 240
StyD4I CCNGG 1 cut(s) 274
StyI CCWWGG 1 cut(s) 113
TaaI ACNGT 3 cut(s) 151, 157, 479
TaqI TCGA 1 cut(s) 363
TasI AATT 1 cut(s) 61
TatI WGTACW 3 cut(s) 75, 93, 128
TfiI GAWTC 1 cut(s) 365
Tru1I TTAA 1 cut(s) 45
Tru9I TTAA 1 cut(s) 45
TscAI CASTG 2 cut(s) 27, 156
TseFI GTSAC 1 cut(s) 151
Tsp45I GTSAC 1 cut(s) 151
TspDTI ATGAA 4 cut(s) 17, 181, 333, 387
TspGWI ACGGA 1 cut(s) 177
TspRI CASTG 2 cut(s) 27, 156
VpaK11BI GGWCC 2 cut(s) 272, 439
XceI RCATGY 1 cut(s) 179
XspI CTAG 2 cut(s) 36, 240
ZrmI AGTACT 1 cut(s) 77
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.