Rmu_ssc0000432.1_g000070

E3 ubiquitin-protein ligase that mediates ubiquitination and subsequent proteasomal degradation of target proteins. E3 ubiquitin ligases accept ubiquitin from an E2 ubiquitin- conjugating enzyme in the form of a thioester and then directly transfers the ubiquitin to targeted substrates

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000432.1
Physical Location & Seq
Reverse (-)
242702 .. 243211
510 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000432.1_g000070.1.cds

Sequence Viewer

Length: 333 bp
atgttgacactgatctttaactgttttggccgtcagttctgcttgcattttgaggcattccacattggaacagcacctgtatacatggccttccttagattcatgggtgatgacgatgaggccaagcaattcacttacagtctcgaagttggtggcggtggcagaaagctgacatggcaaggaattccgaggagtattcgcgatagccaccgaaaggttcgtgacagtcaagatggactgatcattcagaggaacttggcactctttttctcaggtggtaataggcaggagctgaagctgaaagtggcgggccgtatatggaaagaacactga

Protein Analysis

110

Amino Acids

12.69

Weight (kDa)

9.62

Isoelectric Point (pI)

36.05

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 81
AccII CGCG 1 cut(s) 201
AciI CCGC 2 cut(s) 156, 308
AcoI YGGCCR 1 cut(s) 28
AcsI RAATTY 1 cut(s) 183
AcuI CTGAAG 1 cut(s) 314
AfiI CCNNNNNNNGG 1 cut(s) 214
AluBI AGCT 3 cut(s) 169, 292, 298
AluI AGCT 3 cut(s) 169, 292, 298
Alw26I GTCTC 1 cut(s) 146
AlwNI CAGNNNCTG 2 cut(s) 77, 292
AoxI GGCC 4 cut(s) 28, 87, 120, 310
ApoI RAATTY 1 cut(s) 183
AspS9I GGNCC 1 cut(s) 310
AsuHPI GGTGA 1 cut(s) 119
BccI CCATC 1 cut(s) 227
BceAI ACGGC 2 cut(s) 15, 297
BclI TGATCA 1 cut(s) 240
BcoDI GTCTC 1 cut(s) 146
BmgT120I GGNCC 1 cut(s) 310
BsaJI CCNNGG 1 cut(s) 188
Bsc4I CCNNNNNNNGG 1 cut(s) 214
BseDI CCNNGG 1 cut(s) 188
BseLI CCNNNNNNNGG 1 cut(s) 214
BseMII CTCAG 1 cut(s) 285
BseRI GAGGAG 1 cut(s) 205
Bsh1236I CGCG 1 cut(s) 201
BshFI GGCC 4 cut(s) 30, 89, 122, 312
BslI CCNNNNNNNGG 1 cut(s) 214
BsmAI GTCTC 1 cut(s) 146
BsmI GAATGC 1 cut(s) 56
BsnI GGCC 4 cut(s) 30, 89, 122, 312
Bsp143I GATC 2 cut(s) 12, 240
Bsp68I TCGCGA 1 cut(s) 201
BspACI CCGC 2 cut(s) 156, 308
BspANI GGCC 4 cut(s) 30, 89, 122, 312
BspCNI CTCAG 1 cut(s) 284
BspFNI CGCG 1 cut(s) 201
BssECI CCNNGG 1 cut(s) 188
BssMI GATC 2 cut(s) 12, 240
BssNAI GTATAC 1 cut(s) 82
Bst1107I GTATAC 1 cut(s) 82
Bst4CI ACNGT 3 cut(s) 23, 140, 227
BstC8I GCNNGC 2 cut(s) 44, 310
BstDEI CTNAG 2 cut(s) 95, 271
BstFNI CGCG 1 cut(s) 201
BstKTI GATC 2 cut(s) 15, 243
BstMAI GTCTC 1 cut(s) 146
BstMBI GATC 2 cut(s) 12, 240
BstMWI GCNNNNNNNGC 1 cut(s) 175
BstUI CGCG 1 cut(s) 201
BstZ17I GTATAC 1 cut(s) 82
BsuRI GGCC 4 cut(s) 30, 89, 122, 312
BtsIMutI CAGTG 2 cut(s) 8, 328
BtuMI TCGCGA 1 cut(s) 201
Cac8I GCNNGC 2 cut(s) 44, 310
CaiI CAGNNNCTG 2 cut(s) 77, 292
Cfr13I GGNCC 1 cut(s) 310
CviAII CATG 3 cut(s) 85, 103, 174
CviJI RGCY 8 cut(s) 30, 89, 122, 169, 207, 292, 298, 312
CviKI_1 RGCY 8 cut(s) 30, 89, 122, 169, 207, 292, 298, 312
DdeI CTNAG 2 cut(s) 95, 271
DpnI GATC 2 cut(s) 14, 242
DpnII GATC 2 cut(s) 12, 240
EaeI YGGCCR 1 cut(s) 28
Eco57I CTGAAG 1 cut(s) 314
EcoRI GAATTC 1 cut(s) 183
FaeI CATG 3 cut(s) 88, 106, 177
FaiI YATR 6 cut(s) 82, 86, 104, 175, 317, 319
FatI CATG 3 cut(s) 84, 102, 173
FauI CCCGC 1 cut(s) 301
FbaI TGATCA 1 cut(s) 240
FblI GTMKAC 1 cut(s) 81
HaeIII GGCC 4 cut(s) 30, 89, 122, 312
Hin1II CATG 3 cut(s) 88, 106, 177
HincII GTYRAC 1 cut(s) 6
HindII GTYRAC 1 cut(s) 6
HinfI GANTC 1 cut(s) 99
HphI GGTGA 1 cut(s) 119
Hpy166II GTNNAC 2 cut(s) 6, 82
Hpy188I TCNGA 2 cut(s) 189, 249
Hpy188III TCNNGA 4 cut(s) 143, 200, 221, 230
Hpy8I GTNNAC 2 cut(s) 6, 82
HpyAV CCTTC 1 cut(s) 100
HpyCH4III ACNGT 3 cut(s) 23, 140, 227
HpyCH4V TGCA 1 cut(s) 46
HpyF10VI GCNNNNNNNGC 1 cut(s) 175
HpyF3I CTNAG 2 cut(s) 95, 271
Hsp92II CATG 3 cut(s) 88, 106, 177
Ksp22I TGATCA 1 cut(s) 240
Kzo9I GATC 2 cut(s) 12, 240
LmnI GCTCC 1 cut(s) 289
LpnPI CCDG 3 cut(s) 90, 258, 272
MaeIII GTNAC 1 cut(s) 221
MalI GATC 2 cut(s) 14, 242
MboI GATC 2 cut(s) 12, 240
MluCI AATT 2 cut(s) 128, 183
MnlI CCTC 4 cut(s) 46, 112, 183, 243
MseI TTAA 1 cut(s) 18
Mva1269I GAATGC 1 cut(s) 56
MvnI CGCG 1 cut(s) 201
MwoI GCNNNNNNNGC 1 cut(s) 175
NdeII GATC 2 cut(s) 12, 240
NlaIII CATG 3 cut(s) 88, 106, 177
NmuCI GTSAC 1 cut(s) 221
NruI TCGCGA 1 cut(s) 201
PctI GAATGC 1 cut(s) 56
PfeI GAWTC 1 cut(s) 99
PspPI GGNCC 1 cut(s) 310
PstNI CAGNNNCTG 2 cut(s) 77, 292
RruI TCGCGA 1 cut(s) 201
SaqAI TTAA 1 cut(s) 18
Sau3AI GATC 2 cut(s) 12, 240
Sau96I GGNCC 1 cut(s) 310
SetI ASST 6 cut(s) 79, 171, 219, 277, 294, 300
Sse9I AATT 2 cut(s) 128, 183
SsiI CCGC 2 cut(s) 156, 308
TaaI ACNGT 3 cut(s) 23, 140, 227
TaqI TCGA 1 cut(s) 144
TasI AATT 2 cut(s) 128, 183
TfiI GAWTC 1 cut(s) 99
Tru1I TTAA 1 cut(s) 18
Tru9I TTAA 1 cut(s) 18
TscAI CASTG 1 cut(s) 15
TseFI GTSAC 1 cut(s) 221
Tsp45I GTSAC 1 cut(s) 221
TspDTI ATGAA 1 cut(s) 91
TspRI CASTG 1 cut(s) 15
XapI RAATTY 1 cut(s) 183
XmiI GTMKAC 1 cut(s) 81
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.