Rorug03G0173600

E3 ubiquitin-protein ligase that mediates ubiquitination and subsequent proteasomal degradation of target proteins. E3 ubiquitin ligases accept ubiquitin from an E2 ubiquitin- conjugating enzyme in the form of a thioester and then directly transfers the ubiquitin to targeted substrates

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000003
Physical Location & Seq
Reverse (-)
14669646 .. 14669843
198 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug03G0173600.1

Sequence Viewer

Length: 198 bp
ATGTGGAAGCTAAAGATTGCAGAGGGAGGGAATCCATGGCTGCGGACGCTCAACAACCACGTCGGCCAGCAAGTCTGGGAGTTCGATCCCAAGCTCGGAACTCTGGCCGAGCTTAAGGAGGTCGAGAAGGCTTGCGAGCACTACCATAACCACCGCTTCGTTCACAAGCACAGCTCCGATCGGCTCATGCGCATTTAG

Protein Analysis

65

Amino Acids

7.76

Weight (kDa)

8.93

Isoelectric Point (pI)

31.16

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 191
AciI CCGC 2 cut(s) 43, 154
AclWI GGATC 1 cut(s) 80
AcoI YGGCCR 2 cut(s) 64, 105
AfiI CCNNNNNNNGG 1 cut(s) 95
AflII CTTAAG 1 cut(s) 113
AjiI CACGTC 1 cut(s) 61
AluBI AGCT 4 cut(s) 10, 94, 112, 174
AluI AGCT 4 cut(s) 10, 94, 112, 174
Alw21I GWGCWC 1 cut(s) 141
AlwI GGATC 1 cut(s) 80
AoxI GGCC 2 cut(s) 64, 105
ApeKI GCWGC 1 cut(s) 40
AspLEI GCGC 1 cut(s) 192
Bbv12I GWGCWC 1 cut(s) 141
BbvI GCAGC 1 cut(s) 27
BfrI CTTAAG 1 cut(s) 113
BisI GCNGC 1 cut(s) 41
BlsI GCNGC 1 cut(s) 42
BmgBI CACGTC 1 cut(s) 61
BsaJI CCNNGG 1 cut(s) 35
Bsc4I CCNNNNNNNGG 1 cut(s) 95
BseDI CCNNGG 1 cut(s) 35
BseLI CCNNNNNNNGG 1 cut(s) 95
BseXI GCAGC 1 cut(s) 27
Bsh1285I CGRYCG 1 cut(s) 181
BshFI GGCC 2 cut(s) 66, 107
BsiEI CGRYCG 1 cut(s) 181
BsiHKAI GWGCWC 1 cut(s) 141
BslI CCNNNNNNNGG 1 cut(s) 95
BsnI GGCC 2 cut(s) 66, 107
Bsp1286I GDGCHC 1 cut(s) 141
Bsp143I GATC 2 cut(s) 85, 178
Bsp19I CCATGG 1 cut(s) 35
BspACI CCGC 2 cut(s) 43, 154
BspANI GGCC 2 cut(s) 66, 107
BspPI GGATC 1 cut(s) 80
BspTI CTTAAG 1 cut(s) 113
BssECI CCNNGG 1 cut(s) 35
BssMI GATC 2 cut(s) 85, 178
BssT1I CCWWGG 1 cut(s) 35
BstAFI CTTAAG 1 cut(s) 113
BstC8I GCNNGC 3 cut(s) 68, 133, 137
BstDSI CCRYGG 1 cut(s) 35
BstHHI GCGC 1 cut(s) 192
BstKTI GATC 2 cut(s) 88, 181
BstMBI GATC 2 cut(s) 85, 178
BstMCI CGRYCG 1 cut(s) 181
BstMWI GCNNNNNNNGC 1 cut(s) 46
BstV1I GCAGC 1 cut(s) 27
BsuRI GGCC 2 cut(s) 66, 107
BtgI CCRYGG 1 cut(s) 35
BtrI CACGTC 1 cut(s) 61
Cac8I GCNNGC 3 cut(s) 68, 133, 137
CfoI GCGC 1 cut(s) 192
CseI GACGC 1 cut(s) 55
CviAII CATG 2 cut(s) 36, 187
CviJI RGCY 9 cut(s) 10, 40, 66, 94, 107, 112, 131, 174, 184
CviKI_1 RGCY 9 cut(s) 10, 40, 66, 94, 107, 112, 131, 174, 184
DpnI GATC 2 cut(s) 87, 180
DpnII GATC 2 cut(s) 85, 178
EaeI YGGCCR 2 cut(s) 64, 105
Eco130I CCWWGG 1 cut(s) 35
EcoT14I CCWWGG 1 cut(s) 35
ErhI CCWWGG 1 cut(s) 35
FaeI CATG 2 cut(s) 39, 190
FaiI YATR 3 cut(s) 37, 147, 188
FatI CATG 2 cut(s) 35, 186
Fnu4HI GCNGC 1 cut(s) 41
Fsp4HI GCNGC 1 cut(s) 41
FspAI RTGCGCAY 1 cut(s) 191
FspI TGCGCA 1 cut(s) 191
GlaI GCGC 1 cut(s) 191
GluI GCNGC 1 cut(s) 41
HaeIII GGCC 2 cut(s) 66, 107
HgaI GACGC 1 cut(s) 55
HhaI GCGC 1 cut(s) 192
Hin1II CATG 2 cut(s) 39, 190
Hin6I GCGC 1 cut(s) 190
HinP1I GCGC 1 cut(s) 190
HinfI GANTC 1 cut(s) 31
Hpy166II GTNNAC 1 cut(s) 163
Hpy188I TCNGA 2 cut(s) 98, 178
Hpy188III TCNNGA 1 cut(s) 124
Hpy8I GTNNAC 1 cut(s) 163
Hpy99I CGWCG 1 cut(s) 65
HpyAV CCTTC 1 cut(s) 121
HpyCH4IV ACGT 1 cut(s) 60
HpyCH4V TGCA 1 cut(s) 20
HpyF10VI GCNNNNNNNGC 1 cut(s) 46
HpySE526I ACGT 1 cut(s) 60
Hsp92II CATG 2 cut(s) 39, 190
HspAI GCGC 1 cut(s) 190
Kzo9I GATC 2 cut(s) 85, 178
LmnI GCTCC 1 cut(s) 179
LpnPI CCDG 3 cut(s) 61, 80, 89
Lsp1109I GCAGC 1 cut(s) 27
MaeII ACGT 1 cut(s) 60
MalI GATC 2 cut(s) 87, 180
MboI GATC 2 cut(s) 85, 178
MhlI GDGCHC 1 cut(s) 141
MnlI CCTC 3 cut(s) 16, 20, 112
MseI TTAA 1 cut(s) 114
MspCI CTTAAG 1 cut(s) 113
MwoI GCNNNNNNNGC 1 cut(s) 46
NcoI CCATGG 1 cut(s) 35
NdeII GATC 2 cut(s) 85, 178
NlaIII CATG 2 cut(s) 39, 190
NmeAIII GCCGAG 1 cut(s) 133
NsbI TGCGCA 1 cut(s) 191
PfeI GAWTC 1 cut(s) 31
PkrI GCNGC 1 cut(s) 42
Ple19I CGATCG 1 cut(s) 181
PvuI CGATCG 1 cut(s) 181
SaqAI TTAA 1 cut(s) 114
SatI GCNGC 1 cut(s) 41
Sau3AI GATC 2 cut(s) 85, 178
SduI GDGCHC 1 cut(s) 141
SetI ASST 6 cut(s) 12, 63, 96, 114, 123, 176
SmlI CTYRAG 1 cut(s) 113
SmoI CTYRAG 1 cut(s) 113
SsiI CCGC 2 cut(s) 43, 154
StyI CCWWGG 1 cut(s) 35
TaiI ACGT 1 cut(s) 63
TaqI TCGA 2 cut(s) 84, 123
TfiI GAWTC 1 cut(s) 31
Tru1I TTAA 1 cut(s) 114
Tru9I TTAA 1 cut(s) 114
TseI GCWGC 1 cut(s) 40
Vha464I CTTAAG 1 cut(s) 113
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.