Rroxscaffold_157G00438290

B3 DNA binding domain

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000157
Physical Location & Seq
Reverse (-)
574 .. 1496
923 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_157G00438290.1

Sequence Viewer

Length: 219 bp
ATGTCTGATTTTGTGCTCATGGAGAGTGAAGACCCTTTGAATTCTCTGGTAGCAATAATCAACCGAGCACCGGAAGAGATGGTTCAAGATTTCGAAGCTTGTGCAGATTGCACTCAGAAGTGTTTGCTGATTCATAGGAATAAGAAAAGTGGTTCCCATATCGAAACCTCTTTTTTCAAAATCATGTTTGGAAAACAGTTTTCTAAAGTTATGGTATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

72

Amino Acids

8.22

Weight (kDa)

5.55

Isoelectric Point (pI)

60.8

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 40
AfiI CCNNNNNNNGG 1 cut(s) 70
AgsI TTSAA 3 cut(s) 40, 86, 178
AluBI AGCT 1 cut(s) 98
AluI AGCT 1 cut(s) 98
Alw21I GWGCWC 2 cut(s) 18, 70
ApoI RAATTY 1 cut(s) 40
AsuII TTCGAA 1 cut(s) 93
BbsI GAAGAC 1 cut(s) 36
Bbv12I GWGCWC 2 cut(s) 18, 70
BccI CCATC 1 cut(s) 73
BcgI CGANNNNNNTGC 2 cut(s) 83, 117
BmiI GGNNCC 1 cut(s) 154
BpiI GAAGAC 1 cut(s) 36
Bpu14I TTCGAA 1 cut(s) 93
BsaWI WCCGGW 1 cut(s) 70
Bsc4I CCNNNNNNNGG 1 cut(s) 70
BseLI CCNNNNNNNGG 1 cut(s) 70
BseMII CTCAG 1 cut(s) 128
BsgI GTGCAG 1 cut(s) 123
BsiHKAI GWGCWC 2 cut(s) 18, 70
BsiSI CCGG 1 cut(s) 71
BslI CCNNNNNNNGG 1 cut(s) 70
Bsp119I TTCGAA 1 cut(s) 93
Bsp1286I GDGCHC 2 cut(s) 18, 70
BspCNI CTCAG 1 cut(s) 127
BspLI GGNNCC 1 cut(s) 154
BspT104I TTCGAA 1 cut(s) 93
Bst4CI ACNGT 1 cut(s) 198
Bst6I CTCTTC 1 cut(s) 69
BstBI TTCGAA 1 cut(s) 93
BstDEI CTNAG 1 cut(s) 114
BstV2I GAAGAC 1 cut(s) 36
CviAII CATG 2 cut(s) 19, 184
CviJI RGCY 1 cut(s) 98
CviKI_1 RGCY 1 cut(s) 98
DdeI CTNAG 1 cut(s) 114
Eam1104I CTCTTC 1 cut(s) 69
EarI CTCTTC 1 cut(s) 69
EcoRI GAATTC 1 cut(s) 40
FaeI CATG 2 cut(s) 22, 187
FaiI YATR 6 cut(s) 20, 135, 159, 185, 212, 217
FatI CATG 2 cut(s) 18, 183
HapII CCGG 1 cut(s) 71
Hin1II CATG 2 cut(s) 22, 187
HindIII AAGCTT 1 cut(s) 96
HinfI GANTC 1 cut(s) 130
HpaII CCGG 1 cut(s) 71
Hpy188I TCNGA 2 cut(s) 7, 117
Hpy188III TCNNGA 1 cut(s) 86
HpyCH4III ACNGT 1 cut(s) 198
HpyCH4V TGCA 2 cut(s) 104, 111
HpyF3I CTNAG 1 cut(s) 114
Hsp92II CATG 2 cut(s) 22, 187
LpnPI CCDG 2 cut(s) 32, 84
MboII GAAGA 2 cut(s) 41, 86
MhlI GDGCHC 2 cut(s) 18, 70
MluCI AATT 1 cut(s) 40
MnlI CCTC 1 cut(s) 178
MspI CCGG 1 cut(s) 71
NlaIII CATG 2 cut(s) 22, 187
NlaIV GGNNCC 1 cut(s) 154
NspV TTCGAA 1 cut(s) 93
PfeI GAWTC 1 cut(s) 130
PspN4I GGNNCC 1 cut(s) 154
SduI GDGCHC 2 cut(s) 18, 70
SetI ASST 2 cut(s) 100, 170
SfuI TTCGAA 1 cut(s) 93
SgeI CNNG 7 cut(s) 31, 59, 77, 83, 98, 111, 196
Sse9I AATT 1 cut(s) 40
TaaI ACNGT 1 cut(s) 198
TaqI TCGA 2 cut(s) 93, 162
TasI AATT 1 cut(s) 40
TfiI GAWTC 1 cut(s) 130
TspDTI ATGAA 1 cut(s) 122
XapI RAATTY 1 cut(s) 40
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.