Rroxscaffold_1G00008840

LOB domain-containing protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
OG0003044
Physical Location & Seq
Forward (+)
11117623 .. 11118470
848 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00008840.1

Sequence Viewer

Length: 645 bp
ATGGTAATGATGAGTCGACAGAACAATTCATTTGGTCAACTTCCAGGGATGACGACTTTGAACACAATCACACCTTGTGCTGCATGTAAGCTCTTGAGAAGAAAATGTGCTGAAGAATGCCCTTTCTCTCCCTATTTCTCCCCACATGAACCCCACAAATTTTCAGCTGTCCACAAAGTCTTTGGTGCAAGCAATGTCTCCAAGTTGCTAATGGAGGTGTCAGAGAACCAAAGAGCTGATGCTGCAAATAGTATGGTTTATGAAGCAAACCTGAGATTGAGAGACCCGGTGTACGGATGCATGGGTGTAATTTCAACCTTGCAGCAAAAAATTCAATCTTTACAAACCGAACTTGATGCTGTTAGGTCCGAAATGTTAAGATACAAGTATAAAGAAGCACCTAGTCAGATCGTTTCTTCTAGAGATCATATTCATCCTCATCATGCTGCTGCTGCTTTAGTTTCTTCTGGGATGGTGTCTATTGCTGCACCACCGCAATCAATTTTGACATCACCACCGGCTGCTCCTCCATCTTCAGTTGTCTTTTCTTCGTCTTCTTCAACTTCAACTTCTTTATGTACACCCTCGACAATCACAACTGGTTATAGTTCCTTGTCAAGCGACAATCTCCCGTATTTTGATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
LOB

Protein Analysis

214

Amino Acids

23.19

Weight (kDa)

8.22

Isoelectric Point (pI)

72.36

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
LOB PF03195 25 - 122 5.9e-40 Lateral organ boundaries (LOB) domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 16
AciI CCGC 1 cut(s) 494
AcsI RAATTY 2 cut(s) 158, 330
AcuI CTGAAG 2 cut(s) 132, 519
AdeI CACNNNGTG 1 cut(s) 77
AfaI GTAC 2 cut(s) 293, 580
AfiI CCNNNNNNNGG 1 cut(s) 293
AgsI TTSAA 5 cut(s) 61, 315, 335, 561, 567
AjnI CCWGG 1 cut(s) 43
AluBI AGCT 3 cut(s) 91, 167, 236
AluI AGCT 3 cut(s) 91, 167, 236
Alw26I GTCTC 2 cut(s) 202, 276
ApeKI GCWGC 8 cut(s) 80, 242, 322, 446, 449, 452, 485, 521
ApoI RAATTY 2 cut(s) 158, 330
AspS9I GGNCC 1 cut(s) 366
AsuC2I CCSGG 1 cut(s) 287
AsuHPI GGTGA 1 cut(s) 504
AvaII GGWCC 1 cut(s) 366
BbsI GAAGAC 1 cut(s) 546
BbvI GCAGC 8 cut(s) 67, 229, 334, 433, 436, 439, 472, 508
BccI CCATC 2 cut(s) 466, 538
BcgI CGANNNNNNTGC 2 cut(s) 338, 372
BciT130I CCWGG 1 cut(s) 45
BcnI CCSGG 1 cut(s) 287
BcoDI GTCTC 2 cut(s) 202, 276
BfaI CTAG 2 cut(s) 402, 420
BisI GCNGC 8 cut(s) 81, 243, 323, 447, 450, 453, 486, 522
BlsI GCNGC 8 cut(s) 82, 244, 324, 448, 451, 454, 487, 523
Bme1390I CCNGG 2 cut(s) 45, 287
Bme18I GGWCC 1 cut(s) 366
BmgT120I GGNCC 1 cut(s) 366
BmrFI CCNGG 2 cut(s) 45, 287
BmsI GCATC 3 cut(s) 229, 287, 346
BpiI GAAGAC 1 cut(s) 546
BpuEI CTTGAG 1 cut(s) 115
BpuMI CCSGG 1 cut(s) 287
BsaI GGTCTC 1 cut(s) 276
BsaJI CCNNGG 1 cut(s) 44
Bsc4I CCNNNNNNNGG 1 cut(s) 293
Bse118I RCCGGY 1 cut(s) 517
Bse1I ACTGG 1 cut(s) 604
Bse3DI GCAATG 1 cut(s) 199
BseBI CCWGG 1 cut(s) 45
BseDI CCNNGG 1 cut(s) 44
BseGI GGATG 4 cut(s) 54, 302, 433, 477
BseLI CCNNNNNNNGG 1 cut(s) 293
BseMI GCAATG 1 cut(s) 199
BseMII CTCAG 1 cut(s) 263
BseNI ACTGG 1 cut(s) 604
BseRI GAGGAG 1 cut(s) 516
BseXI GCAGC 8 cut(s) 67, 229, 334, 433, 436, 439, 472, 508
BsgI GTGCAG 1 cut(s) 471
BsiSI CCGG 2 cut(s) 287, 518
BslI CCNNNNNNNGG 1 cut(s) 293
BsmAI GTCTC 2 cut(s) 202, 276
BsmI GAATGC 1 cut(s) 122
Bso31I GGTCTC 1 cut(s) 276
Bsp1407I TGTACA 1 cut(s) 578
Bsp143I GATC 2 cut(s) 408, 424
BspACI CCGC 1 cut(s) 494
BspCNI CTCAG 1 cut(s) 264
BspTNI GGTCTC 1 cut(s) 276
BsrDI GCAATG 1 cut(s) 199
BsrFI RCCGGY 1 cut(s) 517
BsrGI TGTACA 1 cut(s) 578
BsrI ACTGG 1 cut(s) 604
BssAI RCCGGY 1 cut(s) 517
BssECI CCNNGG 1 cut(s) 44
BssMI GATC 2 cut(s) 408, 424
Bst2UI CCWGG 1 cut(s) 45
BstAUI TGTACA 1 cut(s) 578
BstC8I GCNNGC 1 cut(s) 190
BstDEI CTNAG 1 cut(s) 272
BstF5I GGATG 4 cut(s) 54, 302, 433, 477
BstKTI GATC 2 cut(s) 411, 427
BstMAI GTCTC 2 cut(s) 202, 276
BstMBI GATC 2 cut(s) 408, 424
BstMWI GCNNNNNNNGC 2 cut(s) 242, 452
BstNI CCWGG 1 cut(s) 45
BstNSI RCATGY 1 cut(s) 87
BstSCI CCNGG 2 cut(s) 43, 285
BstV1I GCAGC 8 cut(s) 67, 229, 334, 433, 436, 439, 472, 508
BstV2I GAAGAC 1 cut(s) 546
BtsCI GGATG 4 cut(s) 54, 302, 433, 477
Cac8I GCNNGC 1 cut(s) 190
Cfr10I RCCGGY 1 cut(s) 517
Cfr13I GGNCC 1 cut(s) 366
Csp6I GTAC 2 cut(s) 292, 579
CviAII CATG 4 cut(s) 84, 146, 301, 443
CviJI RGCY 4 cut(s) 91, 167, 236, 521
CviKI_1 RGCY 4 cut(s) 91, 167, 236, 521
CviQI GTAC 2 cut(s) 292, 579
DdeI CTNAG 1 cut(s) 272
DpnI GATC 2 cut(s) 410, 426
DpnII GATC 2 cut(s) 408, 424
DraIII CACNNNGTG 1 cut(s) 77
Eco31I GGTCTC 1 cut(s) 276
Eco47I GGWCC 1 cut(s) 366
Eco57I CTGAAG 2 cut(s) 132, 519
EcoRII CCWGG 1 cut(s) 43
EcoT22I ATGCAT 1 cut(s) 302
FaeI CATG 4 cut(s) 87, 149, 304, 446
FatI CATG 4 cut(s) 83, 145, 300, 442
FblI GTMKAC 1 cut(s) 16
Fnu4HI GCNGC 8 cut(s) 81, 243, 323, 447, 450, 453, 486, 522
FokI GGATG 4 cut(s) 61, 309, 420, 484
Fsp4HI GCNGC 8 cut(s) 81, 243, 323, 447, 450, 453, 486, 522
FspBI CTAG 2 cut(s) 402, 420
GluI GCNGC 8 cut(s) 81, 243, 323, 447, 450, 453, 486, 522
HapII CCGG 2 cut(s) 287, 518
Hin1II CATG 4 cut(s) 87, 149, 304, 446
HincII GTYRAC 2 cut(s) 17, 38
HindII GTYRAC 2 cut(s) 17, 38
HinfI GANTC 1 cut(s) 13
HpaII CCGG 2 cut(s) 287, 518
HphI GGTGA 1 cut(s) 504
Hpy166II GTNNAC 5 cut(s) 17, 38, 172, 292, 581
Hpy188I TCNGA 3 cut(s) 223, 370, 408
Hpy188III TCNNGA 2 cut(s) 94, 420
Hpy8I GTNNAC 5 cut(s) 17, 38, 172, 292, 581
HpyCH4V TGCA 6 cut(s) 83, 188, 245, 300, 322, 488
HpyF10VI GCNNNNNNNGC 2 cut(s) 242, 452
HpyF3I CTNAG 1 cut(s) 272
Hsp92II CATG 4 cut(s) 87, 149, 304, 446
Kzo9I GATC 2 cut(s) 408, 424
LmnI GCTCC 1 cut(s) 529
LpnPI CCDG 7 cut(s) 30, 57, 284, 300, 453, 531, 585
Lsp1109I GCAGC 8 cut(s) 67, 229, 334, 433, 436, 439, 472, 508
LweI GCATC 3 cut(s) 229, 287, 346
MaeI CTAG 2 cut(s) 402, 420
MalI GATC 2 cut(s) 410, 426
MboI GATC 2 cut(s) 408, 424
MboII GAAGA 8 cut(s) 111, 125, 408, 456, 525, 540, 546, 549
MluCI AATT 5 cut(s) 25, 158, 309, 330, 501
MlyI GAGTC 1 cut(s) 22
MnlI CCTC 4 cut(s) 208, 447, 537, 595
Mph1103I ATGCAT 1 cut(s) 302
MseI TTAA 2 cut(s) 377, 643
MspA1I CMGCKG 1 cut(s) 167
MspI CCGG 2 cut(s) 287, 518
MspR9I CCNGG 2 cut(s) 45, 287
Mva1269I GAATGC 1 cut(s) 122
MvaI CCWGG 1 cut(s) 45
MwoI GCNNNNNNNGC 2 cut(s) 242, 452
NciI CCSGG 1 cut(s) 287
NdeII GATC 2 cut(s) 408, 424
NlaIII CATG 4 cut(s) 87, 149, 304, 446
NsiI ATGCAT 1 cut(s) 302
NspI RCATGY 1 cut(s) 87
PctI GAATGC 1 cut(s) 122
PkrI GCNGC 8 cut(s) 82, 244, 324, 448, 451, 454, 487, 523
PleI GAGTC 1 cut(s) 21
PpsI GAGTC 1 cut(s) 21
Psp6I CCWGG 1 cut(s) 43
PspGI CCWGG 1 cut(s) 43
PspPI GGNCC 1 cut(s) 366
PvuII CAGCTG 1 cut(s) 167
RsaI GTAC 2 cut(s) 293, 580
RsaNI GTAC 2 cut(s) 292, 579
SalI GTCGAC 1 cut(s) 15
SaqAI TTAA 2 cut(s) 377, 643
SatI GCNGC 8 cut(s) 81, 243, 323, 447, 450, 453, 486, 522
Sau3AI GATC 2 cut(s) 408, 424
Sau96I GGNCC 1 cut(s) 366
SchI GAGTC 1 cut(s) 22
ScrFI CCNGG 2 cut(s) 45, 287
SetI ASST 9 cut(s) 76, 93, 169, 219, 238, 273, 320, 368, 403
SfaNI GCATC 3 cut(s) 229, 287, 346
SinI GGWCC 1 cut(s) 366
SmlI CTYRAG 1 cut(s) 94
SmoI CTYRAG 1 cut(s) 94
Sse9I AATT 5 cut(s) 25, 158, 309, 330, 501
SsiI CCGC 1 cut(s) 494
SspMI CTAG 2 cut(s) 402, 420
StyD4I CCNGG 2 cut(s) 43, 285
TaqI TCGA 2 cut(s) 16, 587
TasI AATT 5 cut(s) 25, 158, 309, 330, 501
TatI WGTACW 1 cut(s) 578
Tru1I TTAA 2 cut(s) 377, 643
Tru9I TTAA 2 cut(s) 377, 643
TseI GCWGC 8 cut(s) 80, 242, 322, 446, 449, 452, 485, 521
TspDTI ATGAA 4 cut(s) 18, 162, 276, 422
TspGWI ACGGA 1 cut(s) 309
VpaK11BI GGWCC 1 cut(s) 366
XapI RAATTY 2 cut(s) 158, 330
XbaI TCTAGA 1 cut(s) 419
XceI RCATGY 1 cut(s) 87
XcmI CCANNNNNNNNNTGG 2 cut(s) 179, 208
XmiI GTMKAC 1 cut(s) 16
XspI CTAG 2 cut(s) 402, 420
Zsp2I ATGCAT 1 cut(s) 302
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.