Basic Information

Type: gene

Biological Identity

Species

rosa_roxburghii

Chromosome

GWHEROQ00000002

Orthogroup ID

OG0003159

Physical Location & Seq

Genomic Coordinates Forward (+)

19957632 .. 19961991

Gene Structure 4360 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rroxscaffold_2G00098620.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 198 bp

ATGTGCAATCATTATATGTATAGAGGCAAAATGATGAGGATAGACTACTTCATAGCTGTAGAGCAACTCAAAGATAGGATTGTTTCATGTGAGATGCACGGGCAAGGGATGAATTACAAGGGATTTTTCTTACAACAACTTCACTTGAAAAGCTCAACCTCACTTCCTACAGAATGTGATAGAGGCAGTGTGGACTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0003906 GO:0004518 GO:0004519 GO:0004520 GO:0004527 GO:0004529 GO:0004536 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0005737 GO:0006139 GO:0006259 GO:0006281 GO:0006284 GO:0006725 GO:0006807 GO:0006950 GO:0006974 GO:0008150 GO:0008152 GO:0008296 GO:0008309 GO:0008311 GO:0008408 GO:0009507 GO:0009536 GO:0009987 GO:0016787 GO:0016788 GO:0016796 GO:0016889 GO:0016894 GO:0016895 GO:0033554 GO:0034641 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044237 GO:0044238 GO:0044260 GO:0044424 GO:0044444 GO:0044464 GO:0046483 GO:0050896 GO:0051716 GO:0071704 GO:0090304 GO:0090305 GO:0140097 GO:1901360

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Exo_endo_phos

Protein Analysis

65

Amino Acids

7.64

Weight (kDa)

7.75

Isoelectric Point (pI)

55.83

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003159)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G48425
fragaria_vesca	FvH4_5g07080 FvH4_5g07080 FvH4_5g07080
malus_domestica	MD14G1165700.v1.1
prunus_persica	Prupe.5G159400_v2.0.a1
pyrus_communis	pycom14g13820
rosa_chinensis	RchiOBHm_Chr3g0465631 RchiOBHm_Chr7g0191471
rosa_laevigata	RLG00000004446
rosa_multiflora	Rmu_sc0000550.1_g000024 Rmu_sc0002661.1_g000010 Rmu_sc0003226.1_g000026 Rmu_sc0005734.1_g000004 Rmu_sc0022975.1_g000001 Rmu_sc0031859.1_g000001
rosa_roxburghii	Rroxscaffold_157G00438410 Rroxscaffold_2G00098620 Rroxscaffold_3G00263770 Rroxscaffold_5G00347080 Rroxscaffold_5G00349220 Rroxscaffold_7G00194680
rosa_rugosa	Rorug05G0345200 Rorug06G0510500
rosa_samantha	Rh2AG501600 Rh2CG487600 Rh3BG139700 Rh3BG143200 Rh3DG144500 Rh5BG061000 Rh7AG118600 Rh7BG012100 Rh7BG120600 Rh7CG123400 Rh7DG121500
rosa_wichuraiana	Rw2G044070 Rw7G026230

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AgsI	TTSAA	1 cut(s)	148
AluBI	AGCT	2 cut(s)	56, 153
AluI	AGCT	2 cut(s)	56, 153
BfmI	CTRYAG	2 cut(s)	57, 168
BmsI	GCATC	1 cut(s)	84
BseGI	GGATG	1 cut(s)	114
BstF5I	GGATG	1 cut(s)	114
BstSFI	CTRYAG	2 cut(s)	57, 168
BtsCI	GGATG	1 cut(s)	114
BtsI	GCAGTG	1 cut(s)	193
BtsIMutI	CAGTG	1 cut(s)	193
CviAII	CATG	1 cut(s)	87
CviJI	RGCY	2 cut(s)	56, 153
CviKI_1	RGCY	2 cut(s)	56, 153
FaeI	CATG	1 cut(s)	90
FaiI	YATR	5 cut(s)	15, 17, 21, 53, 88
FatI	CATG	1 cut(s)	86
FokI	GGATG	1 cut(s)	121
Hin1II	CATG	1 cut(s)	90
Hpy166II	GTNNAC	1 cut(s)	193
Hpy8I	GTNNAC	1 cut(s)	193
HpyCH4V	TGCA	2 cut(s)	6, 97
Hsp92II	CATG	1 cut(s)	90
LweI	GCATC	1 cut(s)	84
MluCI	AATT	1 cut(s)	112
MnlI	CCTC	4 cut(s)	17, 30, 169, 176
NlaIII	CATG	1 cut(s)	90
SetI	ASST	3 cut(s)	58, 155, 161
SfaNI	GCATC	1 cut(s)	84
SfcI	CTRYAG	2 cut(s)	57, 168
SgeI	CNNG	6 cut(s)	99, 110, 112, 116, 130, 157
Sse9I	AATT	1 cut(s)	112
TasI	AATT	1 cut(s)	112
TscAI	CASTG	1 cut(s)	193
TspDTI	ATGAA	3 cut(s)	40, 75, 125
TspRI	CASTG	1 cut(s)	193

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.